WormBase Tree Display for Variation: WBVar02152602

WBVar02152602 Name: Public_name: tm12344
    Other_name: CE48590:p.Lys47_Phe85delinsTer
      Y54G2A.73a.1:c.139_255delinsTGAATC
    HGVSg: CHROMOSOME_IV:g.3008531_3008692delinsGATTCA
  Sequence_details: SMap: S_parent: Sequence: Y54G2A
    Flanking_sequences: ttgcaaagtagatggatttttcgattcatc ttcaggctccaaatctccatttccacgctc
    Mapping_target: Y54G2A
    Source_location: 7 CHROMOSOME_IV 3008530 3008693 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GATTCA
      Deletion
    PCR_product: tm12344_external
      tm12344_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 12344
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00219425
    Transcript: Y54G2A.73a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Remark: 258309/258310-GATTCA-258471/258472(162 bp deletion + 6 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele