WormBase Tree Display for Variation: WBVar02156717

WBVar02156717 Name: Public_name: gk5890
    HGVSg: CHROMOSOME_IV:g.2999268_3008890del
  Sequence_details: SMap: S_parent: Sequence: Y54G2A
    Flanking_sequences: GGGGTTGTGGTGGTGGTGGTGGTCGGCCCG ATTAATTTCAGACAAAATCCAACAAAAAAA
    Mapping_target: CHROMOSOME_IV
    Type_of_mutation: Deletion
    SeqStatus: Pending_curation
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00051483
    Laboratory: VC
    Person: WBPerson427
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00198012
      WBGene00197276
      WBGene00219425
    Transcript: Y54G2A.63 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      Y54G2A.73b.1 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Intron_number: 1/1
        Exon_number: 1-2/2
      Y54G2A.73a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: 3-?
        CDS_position: 3-?
        Protein_position: 1-?
        Intron_number: 1-10/10
        Exon_number: 1-11/11
      Y54G2A.61 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
  Isolation: Mutagen: CRISPR_Cas9
  Remark: Variation accession generated for Mark Edgley for a set of gk CRISPR alleles.
    Deletion_verification Flanking sequences and deletion extents inferred from design of CRISPR deletion/selection cassette insertion HDR event. QC-PCR assays indicate that the event is perfect, but it was not sequenced.
  Method: Allele