WormBase Tree Display for Variation: WBVar02158619
expand all nodes | collapse all nodes | view schema
WBVar02158619 | Evidence | Person_evidence | WBPerson39938 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ola285 | |||||||
Other_name | CE51009:p.Ile5753Asn | ||||||||
CE51026:p.Ile5753Asn | |||||||||
F45E4.3b.1:c.17258T>A | |||||||||
F45E4.3a.1:c.17258T>A | |||||||||
HGVSg | CHROMOSOME_IV:g.7608882T>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F45E4 | |||||
Flanking_sequences | gtggtctaacccaagaagagctagataaca | tgcacaggctactgaaagtgctcagcaaga | |||||||
Mapping_target | F45E4 | ||||||||
Type_of_mutation | Substitution | t | a | ||||||
SeqStatus | Sequenced | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00053684 | ||||||||
Laboratory | DCR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00018468 | |||||||
Transcript | F45E4.3b.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | F45E4.3b.1:c.17258T>A | ||||||||
HGVSp | CE51026:p.Ile5753Asn | ||||||||
cDNA_position | 17258 | ||||||||
CDS_position | 17258 | ||||||||
Protein_position | 5753 | ||||||||
Exon_number | 15/33 | ||||||||
Codon_change | aTt/aAt | ||||||||
Amino_acid_change | I/N | ||||||||
F45E4.3a.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | F45E4.3a.1:c.17258T>A | ||||||||
HGVSp | CE51009:p.Ile5753Asn | ||||||||
cDNA_position | 17258 | ||||||||
CDS_position | 17258 | ||||||||
Protein_position | 5753 | ||||||||
Exon_number | 15/41 | ||||||||
Codon_change | aTt/aAt | ||||||||
Amino_acid_change | I/N | ||||||||
Possibly_affects | WBGene00018468 | Paper_evidence | WBPaper00065262 | ||||||
Remark | CGC_name cla-1 | ||||||||
Isolation | Mutagen | EMS | |||||||
Forward_genetics | standard phenotypic screen | ||||||||
Genetics | Interpolated_map_position | IV | 3.36501 | ||||||
Description | Phenotype | WBPhenotype:0000436 | Paper_evidence | WBPaper00065262 | |||||
Curator_confirmed | WBPerson39938 | ||||||||
Remark | Defects in ATG-9 synaptic distribution | Paper_evidence | WBPaper00065262 | ||||||
Curator_confirmed | WBPerson39938 | ||||||||
EQ_annotations | GO_term | GO:0045202 | PATO:0000460 | Paper_evidence | WBPaper00065262 | ||||
Curator_confirmed | WBPerson39938 | ||||||||
Reference | WBPaper00065262 | ||||||||
Remark | alt_det = t to a mut_det = I(5753)N | Person_evidence | WBPerson39938 | ||||||
Curator_confirmed | WBPerson51134 | ||||||||
Variation information submitted by WBPerson39938 on 2023-06-16_12:15:19 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||||||
[2023-06-20T20:38:20.436Z WBPerson2987] New Variation: WBPaper00065262, allele of cla-1 | Curator_confirmed | WBPerson2987 | |||||||
Method | Substitution_allele |