WormBase Tree Display for Expr_pattern: Expr5089
expand all nodes | collapse all nodes | view schema
| Expr5089 | Expression_of | Gene | WBGene00004457 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00004457 | ||
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0003679 | ||
| WBbt:0003681 | |||
| WBbt:0005300 | |||
| WBbt:0005735 | |||
| WBbt:0006749 | |||
| WBbt:0006759 | |||
| Type | Reporter_gene | [rpm-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGCCTTCTGTTTATACAATTTGG] 3' and primer B 5' [GAACGAGATTTGGATATTCTTTGG] 3'. | |
| Pattern | Adult Expression: pharynx; Nervous System; nerve ring; ventral nerve cord; neurons along body; tail neurons; unidentified cells; | ||
| Larval Expression: Nervous System; nerve ring; ventral nerve cord; neurons along body; tail neurons; unidentified cells; | |||
| Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. | ||
| Strain: BC11397 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002578 |
