WormBase Tree Display for Expr_pattern: Expr5420
expand all nodes | collapse all nodes | view schema
| Expr5420 | Expression_of | Gene | WBGene00000229 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00000229 | ||
| Homol | Homol_homol | C34E10:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term (12) | |||
| Type | Reporter_gene | [atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'. | |
| Pattern | Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | ||
| Larval Expression: pharynx; anal depressor muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | |||
| Picture | WBPicture0000004092 | ||
| Remark | Also expressed in (comments from author) : high intensity GFP, other tissues may have been masked | ||
| Strain: BC13747 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00004239 |
