WormBase Tree Display for Expr_pattern: Expr5618

Expr5618 Expression_of: Gene: WBGene00017042 Inferred_automatically
    Reflects_endogenous_expression_of: WBGene00017042
  Homol: Homol_homol: D2007:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0005300
      WBbt:0005735
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005772
      WBbt:0006751
      WBbt:0006759
  Type: Reporter_gene: [D2007.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCAAACGGACATACATCAAA] 3' and primer B 5' [CAGCGATTGATCCTGAACATTA] 3'.
  Pattern: Adult Expression: intestine; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in head;
    Larval Expression: intestine; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in head;
  Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated.
    Strain: BC12489
  Reference: WBPaper00006525
  Transgene: WBTransgene00002946
  Historical_gene: WBGene00017043 Note: This object originally referred to WBGene00017043. WBGene00017043 is now considered dead and has been merged into WBGene00017042. WBGene00017042 has replaced WBGene00017043 accordingly.