WormBase Tree Display for Expr_pattern: Expr6888
expand all nodes | collapse all nodes | view schema
| Expr6888 | Expression_of | Gene | WBGene00013766 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00013766 | ||
| Homol | Homol_homol | Y113G7B:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term (11) | |||
| Type | Reporter_gene | [Y113G7B.17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCAAGTCGTCTGACATGATT] 3' and primer B 5' [CCCGCTGGAAAAAGGTTAAT] 3'. | |
| Pattern | Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | ||
| Larval Expression: pharynx; intestine; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | |||
| Remark | Also expressed in (comments from author) : L1s have high intensity GFP, later stages progressively lose intensity | ||
| Strain: BC13727 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003267 |
