WormBase Tree Display for RNAi: WBRNAi00062890
expand all nodes | collapse all nodes | view schema
| WBRNAi00062890 | Homol | Homol_homol | M79:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | tggcattgcatcttccttcaacgctttcactgcaattgtgcagtcatgtcgtttccagtatccctcgtacacgtctccgtactgtccaccgcccaatttgttatgcatgatgatttcggatctatctagttcccattcgtctggcgcgttaggcgacagtgagaacagtccacgtcccttgtcctttttactcgctgggtacattaaaagacatatcagcccatcagcgtgaacactatgatggtgcactaactctccaagtgtgcggaatttgacttcttgtgtgatgaacatctgtaaaaagcgagtatttgcacacttttgagttggttaaatacaataaaaatcacatgattgtggttgaggggttgatcagtgaaatcaagtataagtaaagctcaccttttctgtattatctacattgatccggtagtgaaacactcgaccatcatggcgaacagagattgtatactgtcctatacttgtttcactttctcgtaccaaaaatgagccagtgattccactgcctagtatagcctcagaatcgctccttgagattttgccatgataccacgtgtacttatccaaagagttgtacggagcaataaaattacttggcacccatccaatttcgcctaaccttcgctgattgctcgcatcattttttctcgttgagtataatcgtgcctcacaccactcattg | |||
| Experiment | Laboratory | XR | |||
| Date | 27 May 2004 00:00:00 | ||||
| Treatment | worms exposed to ionizing radiation (120 Gy) | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | M79.1a | Inferred_automatically | RNAi_primary | |
| M79.1g | Inferred_automatically | RNAi_primary | |||
| M79.1b | Inferred_automatically | RNAi_primary | |||
| M79.1d | Inferred_automatically | RNAi_primary | |||
| M79.1f | Inferred_automatically | RNAi_primary | |||
| M79.1e | Inferred_automatically | RNAi_primary | |||
| M79.1c | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00000018 | Inferred_automatically | RNAi_primary | ||
| Transcript | M79.1f.1 | Inferred_automatically | RNAi_primary | ||
| M79.1c.1 | Inferred_automatically | RNAi_primary | |||
| M79.1e.1 | Inferred_automatically | RNAi_primary | |||
| M79.1d.1 | Inferred_automatically | RNAi_primary | |||
| M79.1g.1 | Inferred_automatically | RNAi_primary | |||
| M79.1a.1 | Inferred_automatically | RNAi_primary | |||
| M79.1b.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00024301 | ||||
| Phenotype | WBPhenotype:0000731 | Remark | increased germ-cell apoptosis after exposure to ionizing radiation | ||
| Remark | Germ-cell corpses were counted in adult F1 progeny 24 h after exposure to 120 Gy. | ||||
| Method | RNAi |
