WormBase Tree Display for Strain: WBStrain00027428
expand all nodes | collapse all nodes | view schema
WBStrain00027428 | Status | Live | ||
---|---|---|---|---|
Genotype | mir-124(n4255) IV. | |||
Public_name | MT13292 | |||
Contains | Gene | WBGene00003319 | ||
Variation | WBVar00090811 | |||
Properties | Outcrossed | x2 | ||
Mutagen | UV+TMP | |||
CGC_received | 21 Feb 2007 00:00:00 | |||
Location | CGC | |||
Remark | Made_by: Horvitz Lab | CGC_data_submission | ||
Deletion breakpoints are:GTCGCTCATTGATTCACATCCATTTTGAG / AAGGATGGTT...GAATGCCACGTG / GCCATGATGGGGCTCCCATTGAAT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. | Inferred_automatically | From CGC strain data | ||
Deletion breakpoints are:GTCGCTCATTGATTCACATCCATTTTGAG / AAGGATGGTT...GAATGCCACGTG / GCCATGATGGGGCTCCCATTGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. | Inferred_automatically | From CGC strain data | ||
Mutagen:UV/TMP | Curator_confirmed | WBPerson1983 | ||
Species | Caenorhabditis elegans |