WormBase Tree Display for Variation: WBVar00000158
expand all nodes | collapse all nodes | view schema
| WBVar00000158 | Name | Public_name | amP5 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | T22E5.2a.1:c.*296A>C | ||||||
| HGVSg | CHROMOSOME_X:g.6407099A>C | ||||||
| Sequence_details | SMap | S_parent | Sequence | T22E5 | |||
| Flanking_sequences | aatctcctaaatttcggtatttaaaatgtt | cctcaaaaatatttttcatgtggctaatac | |||||
| Mapping_target | T22E5 | ||||||
| Type_of_mutation | Substitution | a | c | Author_evidence | Jakubowski J | ||
| SeqStatus | Sequenced | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | WU | ||||||
| Detection_method | [Jakuboswki J] DNA Sequencing | ||||||
| Positive_clone | T22E5 | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001622 | |||||
| Transcript | T22E5.2a.1 | VEP_consequence | 3_prime_UTR_variant | ||||
| VEP_impact | MODIFIER | ||||||
| HGVSc | T22E5.2a.1:c.*296A>C | ||||||
| cDNA_position | 1804 | ||||||
| Exon_number | 12/12 | ||||||
| Genetics | Interpolated_map_position | X | -2.91921 | ||||
| Mapping_data | Multi_point | 3849 | |||||
| Remark | [Jakubowski J ] Single nucleotide polymorphism (A to C) at position 22809 of cosmid T22E5 (bases following polymorphism: CCTCAAAAATA) | ||||||
| [WU ] Map = X | |||||||
| [201021 pad] Generated flanks around position 22809 of the T22E5 clone which is an A. | |||||||
| Method | Substitution_allele |
