WormBase Tree Display for Variation: WBVar00000490
expand all nodes | collapse all nodes | view schema
| WBVar00000490 | Evidence | Paper_evidence | WBPaper00005019 | ||
|---|---|---|---|---|---|
| Name | Public_name | bn88 | |||
| Other_name | F54C1.3a.1:c.1978A>T | ||||
| F54C1.3b.1:c.1921A>T | |||||
| F54C1.3a.2:c.1978A>T | |||||
| CE53747:p.Thr641Ser | |||||
| CE11046:p.Thr660Ser | |||||
| HGVSg | CHROMOSOME_I:g.5001786A>T | ||||
| Sequence_details | SMap | S_parent | Sequence | F54C1 | |
| Flanking_sequences | ttttcagaaatattcttcccaagtggaaaa | ctgaactattcaatattctatgcagacagt | |||
| Mapping_target | F54C1 | ||||
| Type_of_mutation | Substitution | a | t | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | SS | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00003221 | |||
| Transcript | F54C1.3a.1 (12) | ||||
| F54C1.3b.1 (12) | |||||
| F54C1.3a.2 (12) | |||||
| Interactor | WBInteraction000557641 | ||||
| Genetics | Interpolated_map_position | I | -0.428729 | ||
| Mapping_data | In_multi_point | 2095 | |||
| Reference | WBPaper00005019 | ||||
| Remark | This substitution is coupled with a downstream deletion of a4945 causing a frameshift at T660 | Paper_evidence | WBPaper00005019 | ||
| Method | Substitution_allele |
