WormBase Tree Display for Variation: WBVar00054757
expand all nodes | collapse all nodes | view schema
WBVar00054757 | Evidence | Paper_evidence | WBPaper00003549 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | cx36 | |||||||
Other_name | CE26812:p.Gln38Ter | ||||||||
F47G6.1a.1:c.112C>T | |||||||||
HGVSg | CHROMOSOME_I:g.1483217C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F47G6 | |||||
Flanking_sequences | gtaccaccaattgtggcatctgaaatgcaa | aattgattgatgaaatgcgtgggtgttcaa | |||||||
Mapping_target | F47G6 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00024337 | ||||||||
WBStrain00024338 | |||||||||
WBStrain00024339 | |||||||||
WBStrain00024341 | |||||||||
WBStrain00024342 | |||||||||
Laboratory | LS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001115 | |||||||
Transcript | F47G6.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F47G6.1a.1:c.112C>T | ||||||||
HGVSp | CE26812:p.Gln38Ter | ||||||||
cDNA_position | 135 | ||||||||
CDS_position | 112 | ||||||||
Protein_position | 38 | ||||||||
Exon_number | 2/12 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000500262 | ||||||||
WBInteraction000500263 | |||||||||
WBInteraction000500279 | |||||||||
WBInteraction000500316 | |||||||||
WBInteraction000504991 | |||||||||
Genetics | Interpolated_map_position | I | -14.6222 | ||||||
Description | Phenotype | WBPhenotype:0000175 | Paper_evidence | WBPaper00003549 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals tend to hypercontract when moving backwards | Paper_evidence | WBPaper00003549 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000642 | Paper_evidence | WBPaper00003549 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutant animals are hyperactive | Paper_evidence | WBPaper00003549 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000664 | Paper_evidence | WBPaper00003549 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Exaggerated bending of the anterior part of the body | Paper_evidence | WBPaper00003549 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00039987 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | A marked reduction in the intensity of SLO-1::GFP puncta in muscle cells across all DAPC(lf) mutants relative to WT was observed. A similar reduction of SLO-1:GFP signal intensity in ventral or dorsal cord neurons of DAPC(lf) mutants was not observed. | Paper_evidence | WBPaper00039987 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003675 | PATO:0000460 | Paper_evidence | WBPaper00039987 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | cimIs1[slo-1a::GFP,rol-6(d)] | Paper_evidence | WBPaper00039987 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001317 | Paper_evidence | WBPaper00039987 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The ACR-16-mediated current response amplitudes from body-wall muscle cells were similar to wild-type (WT). L-AChR mediated photoevoked responses, isolated by blocking L-AChR-meditated responses with DHbetaE, were also unaltered. As measured by recorded evoked NMJ currents from voltage-clamped body-wall muscles in response to blue-light activated ACh release from cholinergic ventral cord motor neurons expressing channelrhodopsin. | Paper_evidence | WBPaper00039987 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003131 | Paper_evidence | WBPaper00039987 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | zxIs6[Punc-17::chop-2(H134R)-yfp; lin-15(+)] | Paper_evidence | WBPaper00039987 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002166 | Paper_evidence | WBPaper00039987 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The resting muscle membrane potential was not altered in mutants; however, the number of muscle action potential (AP) bursts following 10 ms photo-stimulation of cholinergic motor neurons, was significantly enhanced across mutants relative to WT. | Paper_evidence | WBPaper00039987 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003675 | PATO:0000460 | Paper_evidence | WBPaper00039987 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | cimIs1[slo-1a::GFP,rol-6(d)] | Paper_evidence | WBPaper00039987 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000016 | Paper_evidence | WBPaper00003549 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cx36 mutants are not hypersensitive to aldicarb | Paper_evidence | WBPaper00003549 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00003549 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001316 | Paper_evidence | WBPaper00039987 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants did not display any significant variance from controls in the half-time decay of photoevoked currents. | Paper_evidence | WBPaper00039987 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003131 | Paper_evidence | WBPaper00039987 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | zxIs6[Punc-17::chop-2(H134R)-yfp; lin-15(+)] | Paper_evidence | WBPaper00039987 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001400 | Paper_evidence | WBPaper00039987 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Western blot analysis reveals no difference in total SLO-1::GFP protein between WT and DAPC(lf) mutants. | Paper_evidence | WBPaper00039987 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | cimIs1[slo-1a::GFP,rol-6(d)] | Paper_evidence | WBPaper00039987 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001403 | Paper_evidence | WBPaper00039987 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | UNC-38 and ACR-16 were clustered along the nerve cord, similar to WT. | Paper_evidence | WBPaper00039987 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | acr-16(ok789); jaSi4[Pmyo-3:acr-16::gfp] | Paper_evidence | WBPaper00039987 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00039987 | ||||||||
WBPaper00025979 | |||||||||
WBPaper00003549 | |||||||||
WBPaper00018664 | |||||||||
Method | Substitution_allele |