WormBase Tree Display for Variation: WBVar00088114
expand all nodes | collapse all nodes | view schema
WBVar00088114 | Evidence | Paper_evidence | WBPaper00003101 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | js115 | ||||||
Other_name | F56A8.7b.1:c.211C>T | |||||||
F56A8.7a.2:c.211C>T | ||||||||
CE28035:p.Gln71Ter | ||||||||
CE16127:p.Gln71Ter | ||||||||
F56A8.7a.1:c.211C>T | ||||||||
HGVSg | CHROMOSOME_III:g.13278663C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F56A8 | ||||
Flanking_sequences | tcggcaattttatcaaatccagttaacgat | agagtatgttttaaaaaactgaacttttag | ||||||
Mapping_target | F56A8 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003101 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00029049 | |||||||
Laboratory | NM | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006798 | ||||||
Transcript | F56A8.7b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F56A8.7b.1:c.211C>T | |||||||
HGVSp | CE28035:p.Gln71Ter | |||||||
cDNA_position | 321 | |||||||
CDS_position | 211 | |||||||
Protein_position | 71 | |||||||
Exon_number | 4/10 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
F56A8.7a.2 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F56A8.7a.2:c.211C>T | |||||||
HGVSp | CE16127:p.Gln71Ter | |||||||
cDNA_position | 322 | |||||||
CDS_position | 211 | |||||||
Protein_position | 71 | |||||||
Exon_number | 4/10 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
F56A8.7a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F56A8.7a.1:c.211C>T | |||||||
HGVSp | CE16127:p.Gln71Ter | |||||||
cDNA_position | 319 | |||||||
CDS_position | 211 | |||||||
Protein_position | 71 | |||||||
Exon_number | 4/10 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
Genetics | Interpolated_map_position | III | 21.1945 | |||||
Description | Phenotype | WBPhenotype:0001316 | Paper_evidence | WBPaper00032190 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | GABA Light-evoked currents (GABA photo-ePSCs) were drastically reduced. | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | ChR2-YFP was activated in animals swimming in liquid, or on solid substrates, by applying 450-490 nm light. The chromophore essential fro ChR2 function was supplied by growing transgenic animals on medium containing all-trans retinal. | Paper_evidence | WBPaper00032190 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | zxIs6 | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Expression of ChR2-YFP in GABAergic neurons was not affected. | Paper_evidence | WBPaper00032190 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | zxIs3 | Paper_evidence | WBPaper00032190 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00017428 | |||||||
WBPaper00032190 | ||||||||
WBPaper00018583 | ||||||||
WBPaper00016961 | ||||||||
Method | Substitution_allele |