WormBase Tree Display for Variation: WBVar00088276
expand all nodes | collapse all nodes | view schema
WBVar00088276 | Evidence | Paper_evidence | WBPaper00004727 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ks5 | |||||||
Other_name | C40H5.5b.1:c.516+1G>A | ||||||||
C40H5.5a.1:c.600+1G>A | |||||||||
HGVSg | CHROMOSOME_X:g.11766925C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C40H5 | |||||
Flanking_sequences | atttttcatcatgcgtgtttcgtatgtttt | tgagtttttaacaattttaaacaaattgtt | |||||||
Mapping_target | C40H5 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007506 | ||||||||
WBStrain00052442 | |||||||||
Laboratory | FK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006654 | |||||||
Transcript | C40H5.5b.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C40H5.5b.1:c.516+1G>A | ||||||||
Intron_number | 4/8 | ||||||||
C40H5.5a.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C40H5.5a.1:c.600+1G>A | ||||||||
Intron_number | 5/10 | ||||||||
Interactor | WBInteraction000003413 | ||||||||
WBInteraction000003414 | |||||||||
WBInteraction000003415 | |||||||||
WBInteraction000003416 | |||||||||
WBInteraction000503643 | |||||||||
WBInteraction000521604 | |||||||||
WBInteraction000554842 | |||||||||
WBInteraction000554843 | |||||||||
WBInteraction000554844 | |||||||||
WBInteraction000569170 | |||||||||
Genetics | Interpolated_map_position | X | 6.71664 | ||||||
Description | Phenotype | WBPhenotype:0000997 | Paper_evidence | WBPaper00035614 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | ttx-3 mutants showed a strong tendency to migrate toward the cold area of the temperature gradient, regardless of the conditioning temperature | Paper_evidence | WBPaper00035614 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Mutant animals cryophilic, almost completely defective in isothermal tracking. | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001090 | Paper_evidence | WBPaper00031874 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants are less viable than wild-type animals under conditions of heat stress. Reduced thermotolerance in these mutants is not due to a decline in hsf-1 levels | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to a transient increase in temperature (30C or 34C for 15 min), and their heat shock response was measured as the total amount of hsp70 (C12C8.1) mRNA, 2 hours after heat shock | Paper_evidence | WBPaper00031874 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001273 | Paper_evidence | WBPaper00031874 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutations affecting the AFD or AIY neurons reduced heat shock-dependent accumulation of hsp70 (C12C8.1) mRNA at 30C and 34C | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to a transient increase in temperature (30C or 34C for 15 min), and their heat shock response was measured as the total amount of hsp70 (C12C8.1) mRNA, 2 hours after heat shock | Paper_evidence | WBPaper00031874 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00031874 | |||||||
WBPaper00004727 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson557 | |||||||||
Remark | The expression of hsp70 (C12C8.1)::GFP in gcy-8 and ttx-3 mutants was reduced in all somatic cells 2 hours after heat shock, unlike wild-type | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Animals were defective in autoregulation of a ttx-3prom::gfp reporter gene in the AIY interneuron. In Wildtype the expression is strong, in ks5 mutant animals the signal strength is clearly reduced, yet enough freely diffusible GFP protein is made in the cell to allow visualization of the axons. | Paper_evidence | WBPaper00004727 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to a transient increase in temperature (30C or 34C for 15 min), and their heat shock response was measured as the total amount of hsp70 (C12C8.1) mRNA, 2 hours after heat shock | Paper_evidence | WBPaper00031874 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | C12C8.1p::gfp | Paper_evidence | WBPaper00031874 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
ttx-3prom::gfp (mgIs18) | Paper_evidence | WBPaper00004727 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001639 | Paper_evidence | WBPaper00035327 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ttx-3(AIY) mutants roamed twice less than wild type worms on food | Paper_evidence | WBPaper00035327 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002199 | Paper_evidence | WBPaper00049050 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In addition, ttx-3 mutants, which are defective in AIY function (Hobert et al., 1997), did not show the temperature-evoked suppression of RIA activity (Figure 5B)." | Paper_evidence | WBPaper00049050 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006833 | PATO:0000460 | Paper_evidence | WBPaper00049050 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | njIs30[glr-3p::GCaMP3, glr-3p::TagRFP, ges-1p::nls-TagRFP] (V); Parent strain: IK1565 | Paper_evidence | WBPaper00049050 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002513 | Paper_evidence | WBPaper00004727 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Thermotaxis defects mimic those seen upon laser ablation of the AIY interneurons. | Paper_evidence | WBPaper00004727 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_not_observed | WBPhenotype:0000637 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No obvious abnormalities in dauer formation. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000648 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No obvious abnormalities in male mating. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000663 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No obvious abnormalities in osmotic avoidance. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001462 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No obvious abnormalities in chemotaxis to NaCl. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Asymmetric expression in AWC was normal | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (16) | |||||||||
Remark | ks5 is mutated at the splice donor site at exon 5 (G->A) [030414 ck1] | ||||||||
Method | Substitution_allele |