WormBase Tree Display for Variation: WBVar00088324
expand all nodes | collapse all nodes | view schema
WBVar00088324 | Evidence | Paper_evidence | WBPaper00003726 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ku123 | ||||||
Other_name | CE09685:p.Cys302Tyr | |||||||
F26E4.1.1:c.905G>A | ||||||||
HGVSg | CHROMOSOME_I:g.9755881G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F26E4 | ||||
Flanking_sequences | gattgtgtgatatgagagatcgtgctctat | tgatgcgtatgctaaaagtgcgtttggttc | ||||||
Mapping_target | F26E4 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003726 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00026511 | |||||||
WBStrain00026525 | ||||||||
Laboratory | MH | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006352 | ||||||
Transcript | F26E4.1.1 (12) | |||||||
Interactor | WBInteraction000002328 | |||||||
WBInteraction000052121 | ||||||||
WBInteraction000524419 | ||||||||
Genetics | Interpolated_map_position | I | 3.89251 | |||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00026863 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 6% of fertile animals (n=34) exhibited an egg laying defect. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Low | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | unc-29(e403) | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000698 | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 2% animals (n=26) are aberrant in induction of VPCs; <3 of the VPCs, which are induced in wild type animals (P5.p to P7.p), are induced in these animals, as scored by Nomarski optics. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Low | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | unc-29(e403) | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000688 | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 0% animals produced progeny (n=34). | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | unc-29(e403) | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 0% animals display one or more ectopic pseudovulvae (n=117). | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | unc-29(e403) | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001272 | Paper_evidence | WBPaper00026863 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | On average 2.97 VCPs (n=26 animals) are induced to adopt a vulval cell fate, which is near that of wild type, (3/6 VPCs induced n=29). VPCs and fate adoption were scored by Nomarski optics. | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Vulval induction was scored in late L3 to early L4 stage larvae, under Normarski optics. All strains were grown at 20C. | Paper_evidence | WBPaper00026863 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | unc-29(e403) | Paper_evidence | WBPaper00026863 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00026863 | |||||||
WBPaper00022705 | ||||||||
WBPaper00017196 | ||||||||
WBPaper00023691 | ||||||||
WBPaper00010199 | ||||||||
Method | Substitution_allele |