WormBase Tree Display for Variation: WBVar00088433

WBVar00088433 Evidence: Paper_evidence: WBPaper00004523
  Name: Public_name: ky289
    Other_name: F15A2.6a.1:c.683delinsA
      CE40646:p.Trp228Ter
      CE28218:p.Trp228Ter
      F15A2.6b.1:c.683delinsA
    HGVSg: CHROMOSOME_X:g.13492500delinsT
  Sequence_details: SMap: S_parent: Sequence: F15A2
    Flanking_sequences: aaaagtacgacggtcgaaaagcagacgttt agttgtggcgttatcctctacgcattatta
    Mapping_target: F15A2
    Type_of_mutation: Substitution: gg rr
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005268
    Laboratory: CX
    Status: Live
  Affects: Gene: WBGene00004719
    Transcript: F15A2.6b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F15A2.6b.1:c.683delinsA
        HGVSp: CE40646:p.Trp228Ter
        cDNA_position: 799-800
        CDS_position: 683-684
        Protein_position: 228
        Exon_number: 8/19
        Codon_change: tGG/tAG
        Amino_acid_change: W/*
      F15A2.6a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F15A2.6a.1:c.683delinsA
        HGVSp: CE28218:p.Trp228Ter
        cDNA_position: 793-794
        CDS_position: 683-684
        Protein_position: 228
        Exon_number: 8/18
        Codon_change: tGG/tAG
        Amino_acid_change: W/*
    Interactor: WBInteraction000009146
      WBInteraction000502838
      WBInteraction000541723
  Genetics: Interpolated_map_position: X 12.6526
  Description: Phenotype: WBPhenotype:0000061 Paper_evidence: WBPaper00041842
        Curator_confirmed: WBPerson2987
        Remark: Table SIII; note that this conflicts with data in Table 2 reporting that sad-1(ky289) does not significantly affect life span Paper_evidence: WBPaper00041842
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000104 Paper_evidence: WBPaper00032207
        Curator_confirmed: WBPerson712
        Remark: Animals exhibited irreversible neuronal polarity defects. juIs1 containing vesicle clusters, puncta, are present in both ventral axons and dorsal dendrites, whereas in wild-type animals puncta selectively accumulate in axonal processes along the ventral cord but are excluded from dendrites along the dorsal nerve cord. Expression of SAD-1 (from hpEx1431) at the end of the L2 stage did not rescue this defect. Paper_evidence: WBPaper00032207
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00032207
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005303 PATO:0000460 Paper_evidence: WBPaper00032207
                Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: juIs1 Paper_evidence: WBPaper00032207
              Curator_confirmed: WBPerson712
      WBPhenotype:0000436 Paper_evidence: WBPaper00028886
        Curator_confirmed: WBPerson48
        Remark: Localization of the synaptic protein SNB-1 is weakly abnormal, based on expression analysis of a SNB-1::VENUS transgene. Paper_evidence: WBPaper00028886
            Curator_confirmed: WBPerson48
      WBPhenotype:0000616 Paper_evidence: WBPaper00032207
        Curator_confirmed: WBPerson712
        Remark: Animals exhibited reversible synaptic organization defects. juIs1 puncta appeared diffuse or smaller in DD axons, whereas in wild-type animals these puncta were round and discrete along the dorsal nerve cord. Expression of SAD-1 (from hpEx1431) at the end of the L2 stage rescued this defect. Paper_evidence: WBPaper00032207
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00032207
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005270 PATO:0000460 Paper_evidence: WBPaper00032207
                Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: juIs1 Paper_evidence: WBPaper00032207
              Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Paper_evidence: WBPaper00028886
        Curator_confirmed: WBPerson48
    Phenotype_not_observed: WBPhenotype:0000039 Paper_evidence: WBPaper00041842
        Curator_confirmed: WBPerson2987
        Remark: Table 2; note that this conflicts with data in Table SIII reporting that sad-1(ky289) results in a modestly but significantly increased life span Paper_evidence: WBPaper00041842
            Curator_confirmed: WBPerson2987
  Reference: WBPaper00041842
    WBPaper00028886
    WBPaper00032207
  Remark: Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00004719 Amber_UAG_or_Opal_UGA W(228) to stop Paper_evidence: WBPaper00004523
  Method: Substitution_allele