WormBase Tree Display for Variation: WBVar00088972
expand all nodes | collapse all nodes | view schema
WBVar00088972 | Evidence | Paper_evidence | WBPaper00032936 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | mg456 | |||||||
Other_name | W10G6.2a.1:c.877C>T | ||||||||
CE39528:p.Pro303Ser | |||||||||
CE39527:p.Pro293Ser | |||||||||
W10G6.2a.2:c.877C>T | |||||||||
W10G6.2b.1:c.907C>T | |||||||||
HGVSg | CHROMOSOME_X:g.16257543G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | W10G6 | |||||
Flanking_sequences | cacattttgtgggacgccggagtacttggcc | cggaaattattctgaaaaagccttacgacaa | |||||||
Mapping_target | W10G6 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00032936 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | GR | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004789 | |||||||
Transcript | W10G6.2b.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
HGVSc | W10G6.2b.1:c.907C>T | ||||||||
HGVSp | CE39528:p.Pro303Ser | ||||||||
cDNA_position | 907 | ||||||||
CDS_position | 907 | ||||||||
Protein_position | 303 | ||||||||
Exon_number | 9/11 | ||||||||
Codon_change | Ccg/Tcg | ||||||||
Amino_acid_change | P/S | ||||||||
W10G6.2a.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | W10G6.2a.1:c.877C>T | ||||||||
HGVSp | CE39527:p.Pro293Ser | ||||||||
cDNA_position | 978 | ||||||||
CDS_position | 877 | ||||||||
Protein_position | 293 | ||||||||
Exon_number | 10/13 | ||||||||
Codon_change | Ccg/Tcg | ||||||||
Amino_acid_change | P/S | ||||||||
W10G6.2a.2 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
HGVSc | W10G6.2a.2:c.877C>T | ||||||||
HGVSp | CE39527:p.Pro293Ser | ||||||||
cDNA_position | 885 | ||||||||
CDS_position | 877 | ||||||||
Protein_position | 293 | ||||||||
Exon_number | 9/12 | ||||||||
Codon_change | Ccg/Tcg | ||||||||
Amino_acid_change | P/S | ||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | X | 23.6985 | ||||||
Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00032936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | sgk-1 mutants are slow growing | Paper_evidence | WBPaper00032936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00032936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | sgk-1 mutants have decreased brood size | Paper_evidence | WBPaper00032936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00032936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | sgk-1 mutants have decreased body size | Paper_evidence | WBPaper00032936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00032936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00032936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | sgk-1 mutants display a shortened life span | Paper_evidence | WBPaper00032936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00032936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Elevated BODIPY staining on OP50. The fat mass as assessed by Oil-Red-O staining in sgk-1 was not increased as greatly as in rict-1 mutants | Paper_evidence | WBPaper00032936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00032936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Staining with BODIPY-labeled fatty acid vital dye and Oil-Red-O | Paper_evidence | WBPaper00032936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00032936 | ||||||||
Method | Substitution_allele |