WormBase Tree Display for Variation: WBVar00089424
expand all nodes | collapse all nodes | view schema
| WBVar00089424 | Evidence | Paper_evidence | WBPaper00031068 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n324 | ||||||
| Other_name | CE25115:p.Leu444Ter | |||||||
| T19B4.7.1:c.1331T>A | ||||||||
| HGVSg | CHROMOSOME_I:g.5685157A>T | |||||||
| Sequence_details | SMap | S_parent | Sequence | T19B4 | ||||
| Flanking_sequences | cgagaaccagaagacgtcgaacggaggcct | acggtgcagacgaagtcattggaactcctg | ||||||
| Mapping_target | T19B4 | |||||||
| Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | |||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00024161 | |||||||
| WBStrain00026722 | ||||||||
| Laboratory | MT | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00006776 | ||||||
| Transcript | T19B4.7.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | |||||||
| HGVSc | T19B4.7.1:c.1331T>A | |||||||
| HGVSp | CE25115:p.Leu444Ter | |||||||
| cDNA_position | 1394 | |||||||
| CDS_position | 1331 | |||||||
| Protein_position | 444 | |||||||
| Exon_number | 10/19 | |||||||
| Codon_change | tTa/tAa | |||||||
| Amino_acid_change | L/* | |||||||
| Interactor | WBInteraction000500889 | |||||||
| WBInteraction000518897 | ||||||||
| WBInteraction000518900 | ||||||||
| WBInteraction000536176 | ||||||||
| WBInteraction000536177 | ||||||||
| WBInteraction000536178 | ||||||||
| WBInteraction000536179 | ||||||||
| WBInteraction000536180 | ||||||||
| Genetics | Interpolated_map_position | I | 0.309528 | |||||
| Description | Phenotype (26) | |||||||
| Phenotype_not_observed | WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| WBPhenotype:0001931 | Paper_evidence | WBPaper00032907 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | The number of lateral muscle arms did not differ significantly from control animals. | Paper_evidence | WBPaper00032907 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Reference | WBPaper00038152 | |||||||
| WBPaper00040147 | ||||||||
| WBPaper00043908 | ||||||||
| WBPaper00035198 | ||||||||
| WBPaper00001105 | ||||||||
| WBPaper00032907 | ||||||||
| WBPaper00036485 | ||||||||
| Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | |||||||
| [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | ||||||
| Method | Substitution_allele |
