WormBase Tree Display for Variation: WBVar00090634
expand all nodes | collapse all nodes | view schema
WBVar00090634 | Evidence | Paper_evidence | WBPaper00004635 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n2994 | |||||
Other_name | T23G7.1.1:c.681-1G>A | ||||||
T23G7.2a.1:c.244-1430C>T | |||||||
T23G7.1.2:c.681-1G>A | |||||||
HGVSg | CHROMOSOME_II:g.9170822G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | T23G7 | |||
Flanking_sequences | aattataatagtctcaaatatctatttttaa | agcaaatgtggaatgcagtgtatcatcaga | |||||
Mapping_target | T23G7 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004635 | ||
Person_evidence | WBPerson37422 | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00027348 | ||||||
Laboratory | MT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00011965 | |||||
WBGene00001061 | |||||||
Transcript | T23G7.2a.1 | VEP_consequence | intron_variant | ||||
VEP_impact | MODIFIER | ||||||
HGVSc | T23G7.2a.1:c.244-1430C>T | ||||||
Intron_number | 3/9 | ||||||
T23G7.1.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | T23G7.1.1:c.681-1G>A | ||||||
Intron_number | 5/12 | ||||||
T23G7.1.2 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | T23G7.1.2:c.681-1G>A | ||||||
Intron_number | 5/12 | ||||||
Interactor | WBInteraction000503607 | ||||||
WBInteraction000503609 | |||||||
WBInteraction000503614 | |||||||
WBInteraction000503615 | |||||||
WBInteraction000503616 | |||||||
WBInteraction000503617 | |||||||
WBInteraction000503618 | |||||||
WBInteraction000503621 | |||||||
Genetics | Interpolated_map_position | II | 1.08085 | ||||
Reference | WBPaper00004635 | ||||||
Remark | Originally curated incorrectly to this location tataatagtctcaaatatctatttttaagaGcaaatgtggaatgcagtgtatcatcagaca Corrected based on pers comm from Arturo Bujarrabal who prvided the resequencing data. | Person_evidence | WBPerson37422 | ||||
Curator_confirmed | WBPerson1983 | ||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001061 Acceptor | |||||||
Method | Substitution_allele |