WormBase Tree Display for Variation: WBVar00090702
expand all nodes | collapse all nodes | view schema
| WBVar00090702 | Evidence | Paper_evidence | WBPaper00032217 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n3412 | ||||||
| Other_name | Y16B4A.1.1:c.927G>A | |||||||
| CE29366:p.Trp309Ter | ||||||||
| HGVSg | CHROMOSOME_X:g.14781635G>A | |||||||
| Sequence_details | SMap | S_parent | Sequence | F42D1 | ||||
| Flanking_sequences | agttgcttttggcacagcaagtccgaactg | ggagaggtaattttctattatctggaggga | ||||||
| Mapping_target | F42D1 | |||||||
| Type_of_mutation | Substitution | g | a | |||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Laboratory | MT | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00006743 | ||||||
| Transcript | Y16B4A.1.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | |||||||
| HGVSc | Y16B4A.1.1:c.927G>A | |||||||
| HGVSp | CE29366:p.Trp309Ter | |||||||
| cDNA_position | 980 | |||||||
| CDS_position | 927 | |||||||
| Protein_position | 309 | |||||||
| Exon_number | 9/14 | |||||||
| Codon_change | tgG/tgA | |||||||
| Amino_acid_change | W/* | |||||||
| Genetics | Interpolated_map_position | X | 21.3236 | |||||
| Description | Phenotype | WBPhenotype:0000643 | Paper_evidence | WBPaper00032217 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Uncoordinated movement is indistinguishable from that of e151 or n3435. | Paper_evidence | WBPaper00032217 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Recessive | Paper_evidence | WBPaper00032217 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032217 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Phenotype_assay | Genotype | Plin-11::GFP | Paper_evidence | WBPaper00032217 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| WBPhenotype:0002508 | Paper_evidence | WBPaper00032217 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Animals have four extra fluorescent neurons in the ventral nerve cord of adults as compared to wild-type animals. | Paper_evidence | WBPaper00032217 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Recessive | Paper_evidence | WBPaper00032217 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032217 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Phenotype_assay | Genotype | Plin-11::GFP | Paper_evidence | WBPaper00032217 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Reference | WBPaper00032217 | |||||||
| Method | Substitution_allele |
