WormBase Tree Display for Variation: WBVar00090748
expand all nodes | collapse all nodes | view schema
| WBVar00090748 | Evidence | Paper_evidence | WBPaper00013412 | ||||
|---|---|---|---|---|---|---|---|
| WBPaper00027336 | |||||||
| Name | Public_name | n3681 | |||||
| Other_name | CE21225:p.Gly341Arg | ||||||
| VC5.4.1:c.1021G>A | |||||||
| HGVSg | CHROMOSOME_V:g.7083011C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | VC5 | |||
| Flanking_sequences | tatgaactctcgaaaattgaacagaagaca | gatcacccgaaaaaccactatcagatttgg | |||||
| Mapping_target | VC5 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00027336 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00027398 | ||||||
| Laboratory | MT | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00007029 | |||||
| Transcript | VC5.4.1 (12) | ||||||
| Interactor | WBInteraction000503733 | ||||||
| Genetics | Interpolated_map_position | V | 0.546172 | ||||
| Reference | WBPaper00027336 | ||||||
| WBPaper00013412 | |||||||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00007029 Missense 341 G to R | Person_evidence | WBPerson31184" | ||||
| WBPerson31184 | |||||||
| Method | Substitution_allele |
