WormBase Tree Display for Variation: WBVar00091303

WBVar00091303 Evidence: Person_evidence: WBPerson499
  Name: Public_name: np1
    HGVSg: CHROMOSOME_I:g.4569218_4570570delinsAGCGAAC
  Sequence_details: SMap: S_parent: Sequence: D1007
    Flanking_sequences: TAAACTACAGAAGTTCGCTTTTGGA TACCACATTCACATCAGGACAACTGAAG
    Mapping_target: D1007
    Type_of_mutation: Insertion: AGTTCGCT Author_evidence: Mara Andrione
      Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00008608
    Laboratory: IB
    Status: Live
  Affects: Gene: WBGene00000440
    Transcript: D1007.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-461
        CDS_position: ?-458
        Protein_position: ?-153
        Intron_number: 2-3/4
        Exon_number: 1-4/5
    Interactor (18)
  Isolation: Mutagen: UV/TMP
  Genetics: Interpolated_map_position: I -1.04587
    Mapping_data: In_multi_point: 4204
  Description: Phenotype (11)
    Phenotype_not_observed: WBPhenotype:0000306 Paper_evidence: WBPaper00036308
        Curator_confirmed: WBPerson2987
        Remark: The ceh-17(np1) null mutant exhibits no change in expression of the unc-119::YFP transgene in the ALA neuron (Table 2) Paper_evidence: WBPaper00036308
            Curator_confirmed: WBPerson2987
          The ceh-17(np1) null mutant exhibits no change in expression of the rab-3::GFP transgene in the ALA neuron (Table 2) Paper_evidence: WBPaper00036308
            Curator_confirmed: WBPerson2987
          "To determine whether CEH-10 and CEH-14 also play roles in ALA axon migration, we examined unc-53:GFP (pNP21; N. Pujol), which labels several neurons including ALA and the DA neurons of the ventral cord that extend commissural axons, marking body length (Stringham et al., 2002). In wild-type animals this reporter labels the ALA axons during the L1-L2 stages. We first examined unc-53:GFP in ALA in ceh-17(null) and ceh-10(rf) L1-L2 animals and found that expression of the reporter was not detectably impaired (Fig 6A)." Paper_evidence: WBPaper00036308
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0003955 PATO:0000460 Paper_evidence: WBPaper00036308
                Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: unc-119::YFP Paper_evidence: WBPaper00036308
              Curator_confirmed: WBPerson2987
            rab-3::GFP Paper_evidence: WBPaper00036308
              Curator_confirmed: WBPerson2987
            unc-53:GFP Paper_evidence: WBPaper00036308
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000424 Paper_evidence: WBPaper00004283
        Curator_confirmed: WBPerson499
        Remark: a FRMFamide-like reactivity is normally detected in ALA (Schinkmann and Li, 1992) and the vesicular acetylcholine transporter (VAChT) encoded by unc-17 (Alfonso et al., 1993) is expressed in SIAs (J. Duerr, personal communication). Expression of these markers was unaffected in ceh-17 mutants (see Materials and Methods and data not shown). Paper_evidence: WBPaper00004283
            Curator_confirmed: WBPerson499
        EQ_annotations: Anatomy_term: WBbt:0003955 PATO:0000460 Paper_evidence: WBPaper00004283
                Curator_confirmed: WBPerson499
            WBbt:0005361 PATO:0000460 Paper_evidence: WBPaper00004283
                Curator_confirmed: WBPerson499
      WBPhenotype:0001310 Paper_evidence: WBPaper00036308
        Curator_confirmed: WBPerson2987
        Remark: "We found that similar to ceh-17 animals, the ALA neuron is present and its cell body is positioned normally (Fig 1A, DIC images) but the ceh-14(ch3) null mutant animals are completely resistant to the behavioral effects of EGF expression (Table 1)." Paper_evidence: WBPaper00036308
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0003955 PATO:0000460 Paper_evidence: WBPaper00036308
                Curator_confirmed: WBPerson2987
      WBPhenotype:0001765 Paper_evidence: WBPaper00031936
        Curator_confirmed: WBPerson2021
        Remark: Mutants respond normally to CO2 Paper_evidence: WBPaper00031936
            Curator_confirmed: WBPerson2021
        EQ_annotations: Life_stage: WBls:0000057 PATO:0000460 Paper_evidence: WBPaper00031936
                Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: 10% CO2 Paper_evidence: WBPaper00031936
              Curator_confirmed: WBPerson2021
  Reference: WBPaper00031936
    WBPaper00004283
    WBPaper00036308
    WBPaper00050011
    WBPaper00050371
    WBPaper00050847
    WBPaper00056066
    WBPaper00057148
    WBPaper00059734
    WBPaper00064927
  Remark: Updated the context of this variation to reflect a reported Insertion of 8bp at the deletion site in the ZIM lab isolate. Author_evidence: Mara Andrione
      Curator_confirmed: WBPerson1983
  Method: Deletion_and_insertion_allele