WormBase Tree Display for Variation: WBVar00091434

WBVar00091434 Evidence: Paper_evidence: WBPaper00028563
  Name: Public_name: nx34
    Other_name: C54G7.4.1:c.3274+179_3494del
    HGVSg: CHROMOSOME_X:g.5545982_5546581del
  Sequence_details: SMap: S_parent: Sequence: C54G7
    Flanking_sequences: cgtgtctatttgtataatagtttgattttt tcctccagtgaaccccaactcggctaaagt
    Mapping_target: C54G7
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: MX
    Status: Live
  Affects: Gene: WBGene00016935
    Transcript: C54G7.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C54G7.4.1:c.3274+179_3494del
        cDNA_position: ?-3550
        CDS_position: ?-3494
        Protein_position: ?-1165
        Intron_number: 24-26/28
        Exon_number: 25-27/29
  Genetics: Interpolated_map_position: X -4.86567
  Reference: WBPaper00028563
  Remark: Through an unfortunate mishap, stocks of the ifta-1(nx34) strain were lost and hence this hypomorphic allele is not available. However, the likely loss-of-function nx61 allele, which was the main focus of the Blacque et al. (2006) manuscript, was safeguarded and is available for further analysis. Person_evidence: WBPerson2136
  Method: Deletion_allele