WormBase Tree Display for Variation: WBVar00091656
expand all nodes | collapse all nodes | view schema
WBVar00091656 | Name | Public_name | ok359 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.1339818_1341314del | |||||||
Sequence_details | SMap | S_parent | Sequence | K12C11 | ||||
Flanking_sequences | gcgcttgcaatttcacgatgagacctgacg | tagtaggaatgatgataaattagaatcagt | ||||||
Mapping_target | K12C11 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK359_external | |||||||
OK359_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035570 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004888 | ||||||
WBGene00019673 | ||||||||
Transcript | K12C11.1a.1 | VEP_consequence | 3_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | 1538-? | |||||||
Exon_number | 4/4 | |||||||
K12C11.2.1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2-3/4 | |||||||
Exon_number | 1-5/5 | |||||||
Interactor | WBInteraction000501549 | |||||||
WBInteraction000503839 | ||||||||
WBInteraction000504202 | ||||||||
WBInteraction000520941 | ||||||||
Genetics | Mapping_data | In_multi_point | 4668 | |||||
Description | Phenotype (11) | |||||||
Phenotype_not_observed | WBPhenotype:0000475 | Paper_evidence | WBPaper00035491 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No muscle detachment (Mua) phenotype in smo- 1(ok359) worms | Paper_evidence | WBPaper00035491 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00035491 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001813 | Paper_evidence | WBPaper00032296 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Synapsis occurs normally, as assayed by staining with antibodies against HTP-3 and SYP-1. | Paper_evidence | WBPaper00032296 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | Ppie-1::zhp-3::gfp | Paper_evidence | WBPaper00032296 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032296 | |||||||
WBPaper00035491 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |