WormBase Tree Display for Variation: WBVar00092149
expand all nodes | collapse all nodes | view schema
WBVar00092149 | Evidence | Paper_evidence | WBPaper00032446 | ||
---|---|---|---|---|---|
Name | Public_name | ok874 | |||
Other_name | C25F6.4.1:c.530_1833-108del | ||||
HGVSg | CHROMOSOME_X:g.5462404_5465378del | ||||
Sequence_details | SMap | S_parent | Sequence | C25F6 | |
Flanking_sequences | GTTTGTCCCCTCGTCTAAAAACACAAGAACTGTGTGCATGCGAGCCGAAA | CCGTGAAGTGAAAAATCAACAAATTTTATACTCGTATGTATCCTCATGCT | |||
Mapping_target | C25F6 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00031680 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | Curator_confirmed | WBPerson4025 | ||
Affects | Gene | WBGene00016104 | |||
Transcript | C25F6.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||
VEP_impact | HIGH | ||||
HGVSc | C25F6.4.1:c.530_1833-108del | ||||
cDNA_position | 556-? | ||||
CDS_position | 530-? | ||||
Protein_position | 177-? | ||||
Intron_number | 5-13/16 | ||||
Exon_number | 5-13/17 | ||||
Interactor | WBInteraction000573249 | ||||
WBInteraction000573250 | |||||
Isolation | Mutagen | UV/TMP | |||
Description | Phenotype_not_observed (2) | ||||
Reference | WBPaper00032446 | ||||
WBPaper00053867 | |||||
Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf047778 | ||
This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |