WormBase Tree Display for Variation: WBVar00092155
expand all nodes | collapse all nodes | view schema
WBVar00092155 | Name | Public_name | ok880 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE39724:p.His598GlnfsTer15 | |||||||
F13E6.6.1:c.1794_2412del | ||||||||
HGVSg | CHROMOSOME_X:g.10700374_10701544del | |||||||
Sequence_details | SMap | S_parent | Sequence | F13E6 | ||||
Flanking_sequences | acaaaaacttaccttttcaacttctgctct | tgcgatctggataccaagccacgatccatg | ||||||
Mapping_target | F13E6 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok880_external | |||||||
ok880_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031686 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006468 | ||||||
Transcript | F13E6.6.1 (11) | |||||||
Interactor | WBInteraction000052320 | |||||||
WBInteraction000534902 | ||||||||
WBInteraction000534903 | ||||||||
WBInteraction000534904 | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | |||||
Curator_confirmed | WBPerson557 | |||||||
Penetrance | Low | Paper_evidence | WBPaper00045955 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001911 | Paper_evidence | WBPaper00049131 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | We found that the rhgf-1(ok880) and rhgf-1(gk217) mutants were defective in axon regeneration (Fig. 3d and Supplementary Table 2). | Paper_evidence | WBPaper00049131 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000059 | Paper_evidence | WBPaper00028856 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Growth was not significantly different from wild type. Growth was not arrested by the expression of constitutively active GPA-12. | Paper_evidence | WBPaper00028856 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | hs::GPA-12(Q205L) | Paper_evidence | WBPaper00028856 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00028856 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The average size, fluorescence level and number of SNB-1::CFP puncta in cholinergic motor neurons was not significantly different from wild type. | Paper_evidence | WBPaper00028856 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | SNB-1::CFP | Paper_evidence | WBPaper00028856 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000634 | Paper_evidence | WBPaper00028856 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Pumping was not significantly different from wild type. Pumping was decreased substantially by the expression of constitutively active GPA-12. | Paper_evidence | WBPaper00028856 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | rhgf-1(ok880) x4 hs::GPA-12(Q205L) | Paper_evidence | WBPaper00028856 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00028856 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | UNC-13::YFP puncta distribution is similar to wild type in the dorsal cord and suppresses increased puncta due to constitutively active GPA-12. | Paper_evidence | WBPaper00028856 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | UNC-13S::YFP hs::GPA-12(Q205L) | Paper_evidence | WBPaper00028856 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000680 | Paper_evidence | WBPaper00028856 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Paralysis to 1mM aldicarb is indistinguishable from wild type as measured by the percent paralyzed over time. Heat shocked animals were slightly hypersensitive. Completely suppresses Aldicarb hypersensitivity due to constitutively active GPA-12 (Q205L). | Paper_evidence | WBPaper00028856 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00028856 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | hs::GPA-12(Q205L) | Paper_evidence | WBPaper00028856 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000845 | Paper_evidence | WBPaper00028856 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | This mutation has no effect on the time course of paralysis induced by 100uM levamisole compared to wild type. | Paper_evidence | WBPaper00028856 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00028856 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | rhgf-1(ok880) x4 | Paper_evidence | WBPaper00028856 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001413 | Paper_evidence | WBPaper00040813 | ||||||
Curator_confirmed | WBPerson2706 | |||||||
WBPhenotype:0002469 | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The probability and size of response to plate taps decreased with continued taps applied with a 10s interval, similar to the response of N2 animals. | Paper_evidence | WBPaper00038487 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0004027 | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit an escape response (reversal) similar to N2 animals upon an initial plate tap. | Paper_evidence | WBPaper00038487 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038487 | |||||||
WBPaper00040813 | ||||||||
WBPaper00028856 | ||||||||
WBPaper00045955 | ||||||||
WBPaper00049131 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |