WormBase Tree Display for Variation: WBVar00092168
expand all nodes | collapse all nodes | view schema
WBVar00092168 | Name | Public_name | ok895 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | W01B6.1.1:c.229_917+78del | ||||||||
HGVSg | CHROMOSOME_IV:g.10068357_10069261del | ||||||||
Sequence_details | SMap | S_parent | Sequence | W01B6 | |||||
Flanking_sequences | ccagctgtgagcatcggagcacaaaatgct | caatttttctttaaaaatgtaattttctaa | |||||||
Mapping_target | W01B6 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok895_external | ||||||||
ok895_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (21) | |||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000858 | |||||||
Transcript | W01B6.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | W01B6.1.1:c.229_917+78del | ||||||||
cDNA_position | 288-? | ||||||||
CDS_position | 229-? | ||||||||
Protein_position | 77-? | ||||||||
Intron_number | 3-6/7 | ||||||||
Exon_number | 3-6/8 | ||||||||
Interactor (20) | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000232 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that both cwn-1 and cwn-2 mutations not only affected migrations of subsets of neurons (Table 1), but also resulted in defects in axon development and guidance (Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 24 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006827 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A CAN was scored as anteriorly misplaced (Ant.) if its nucleus was anterior to the V3 nucleus and posteriorly misplaced (Post.) if posterior to the V4 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "... because each deletion removes a large portion of the gene, each is likely to eliminate gene function... Mutations in cwn-1, cwn-2, and egl-20 disrupted the migrations of QR descendant cells, as well as others, raising the possibility that they could function through CFZ-2 (Table 1; Desai et al., 1988; Forrester et al., 2004; Harris et al., 1996)... We focused on cwn-1, cwn-2, and egl-20 because they produced defects in QR descendant cell migration (Fig. 4, Table 1), a cfz-2 phenotype." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 47 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004991 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A QR cell descendant was scored as defective if its nucleus was posterior to the V2.a nucleus. Because they occupy positions near each other, the data for SDQR and AVM were combined. The position of AQR, a third QR descendant, was not included because it migrates to a location near other nuclei with similar morphology." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that both cwn-1 and cwn-2 mutations not only affected migrations of subsets of neurons (Table 1), but also resulted in defects in axon development and guidance (Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 45 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006826 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A BDU was scored as defective if its nucleus was posterior to the V1 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000625 | Paper_evidence | WBPaper00064204 | |||||||
Curator_confirmed | WBPerson7196 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that both cwn-1 and cwn-2 mutations not only affected migrations of subsets of neurons (Table 1), but also resulted in defects in axon development and guidance (Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 13 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Low | 10 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term (11) | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Axon morphology was examined by indirect immunofluorescence using anti-serotonin antibody (HSN and CP) or two independent GFP-expressing reporter transgenes, ceh-23::gfp and kal-1::gfp (CAN)." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000883 | Paper_evidence | WBPaper00035405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cwn-2 mutants had anteriorly displaced nerve rings: the nerve ring circled the metacorpus of the pharynx instead of its usual location around the isthmus of the pharynx | Paper_evidence | WBPaper00035405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null (2) | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00060654 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Loss of cwn-2 caused a defective SMDD axonal phenotype, where axons do not extend along the dorsal sublateral cord, suggesting that the axons did not exit the nerve ring due to defects in axon outgrowth or guidance (Figure 1A-C). Expressing cwn-2 using this promoter partially rescues the defective axonal phenotype (Figure 1C). | Paper_evidence | WBPaper00060654 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004972 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004971 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002490 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that both cwn-1 and cwn-2 mutations not only affected migrations of subsets of neurons (Table 1), but also resulted in defects in axon development and guidance (Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 31 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004903 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004901 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004899 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004897 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004895 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004893 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004891 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004889 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004888 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004887 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Axon morphology was examined by indirect immunofluorescence using anti-serotonin antibody (HSN and CP) or two independent GFP-expressing reporter transgenes, ceh-23::gfp and kal-1::gfp (CAN)." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000016 | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % animals paralyzed after 60 min on 1mM aldicarb was not higher than % N2 animals paralyzed. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0000516 | Paper_evidence | WBPaper00031872 | ||||
Curator_confirmed | WBPerson712 | ||||||||
PATO:0000461 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000104 | Paper_evidence | WBPaper00044679 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The cwn-2(ok895) mutation does not affect anteroposterior polarity in the AVG interneuron | Paper_evidence | WBPaper00044679 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003850 | PATO:0000460 | Paper_evidence | WBPaper00044679 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000218 | Paper_evidence | WBPaper00031110 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No significant number of overinduced animals (worms with greater than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000219 | Paper_evidence | WBPaper00031110 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No underinduced animals (worms with fewer than 22 vulval cells or fewer than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00038522 | |||||||
WBPaper00026706 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | cwn-2 has no significant effect on QR.d positioning on its own. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
"We found that both cwn-1 and cwn-2 mutations not only affected migrations of subsets of neurons (Table 1), but also resulted in defects in axon development and guidance (Table 2)." | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A QL cell descendant was scored as misplaced anteriorly if its nucleus was anterior to V4.p. Because they occupy positions near each other, the data for SDQL and PVM were combined. The position of PQR, a third QL descendant, was not included because it migrates to a location near other nuclei with similar morphology." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that both cwn-1 and cwn-2 mutations not only affected migrations of subsets of neurons (Table 1), but also resulted in defects in axon development and guidance (Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "An HSN was scored as defective if its nucleus was posterior to the V4 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000471 | Paper_evidence | WBPaper00038522 | |||||||
WBPaper00026706 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | ALM does not exhibit significant migration defects. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
"We found that both cwn-1 and cwn-2 mutations not only affected migrations of subsets of neurons (Table 1), but also resulted in defects in axon development and guidance (Table 2)." | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||
WBPaper00026706 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "An ALM was scored as anteriorly misplaced (Ant.) if its nucleus was anterior to the V2 nucleus and posteriorly misplaced (Post.) if posterior to the V3 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001681 | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | No abnormal spindle orientation of Bγ | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007830 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0000132 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
GO:0005819 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0001761 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 2 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Axon morphology was examined by indirect immunofluorescence using anti-serotonin antibody (HSN and CP) or two independent GFP-expressing reporter transgenes, ceh-23::gfp and kal-1::gfp (CAN)." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002490 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 2 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Axon morphology was examined by indirect immunofluorescence using anti-serotonin antibody (HSN and CP) or two independent GFP-expressing reporter transgenes, ceh-23::gfp and kal-1::gfp (CAN)." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00038522 | ||||||||
WBPaper00031110 | |||||||||
WBPaper00031872 | |||||||||
WBPaper00035405 | |||||||||
WBPaper00035553 | |||||||||
WBPaper00026706 | |||||||||
WBPaper00044679 | |||||||||
WBPaper00060654 | |||||||||
WBPaper00064204 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |