WormBase Tree Display for Variation: WBVar00092456
expand all nodes | collapse all nodes | view schema
WBVar00092456 | Name | Public_name | ok1201 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name (2) | |||||||||
HGVSg | CHROMOSOME_V:g.3442059_3443232del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F27E11 | |||||
Flanking_sequences | caaacagcaaatagcatttttccacgacga | cccaccaaaccgaggcagccattccgaaga | |||||||
Mapping_target | F27E11 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | OK1201_external | ||||||||
OK1201_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00008500 | ||||||||
WBStrain00008502 | |||||||||
WBStrain00008506 | |||||||||
WBStrain00031864 | |||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000478 | |||||||
Transcript | F27E11.3.1 (11) | ||||||||
Interactor (15) | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 4924 | ||||||
Description | Phenotype | WBPhenotype:0000232 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Similarly, minor defects in CAN and HSN migration are seen in cfz-2(ok1201) mutants (Fig. 5, Table 1)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_hypomorph_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006827 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A CAN was scored as anteriorly misplaced (Ant.) if its nucleus was anterior to the V3 nucleus and posteriorly misplaced (Post.) if posterior to the V4 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | kal-1::gfp | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00035405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | SIA and SIB neurons had guidance errors at multiple positions (mild defects) | Paper_evidence | WBPaper00035405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "QL and its descendants migrate posteriorly whereas QR and its descendants migrate anteriorly (Fig. 1; Sulston and Horvitz, 1977). In cfz-2 mutants, the migrations of QR descendants terminated posterior to their normal position 11.8% of the time (Fig. 4, Table 1). QL descendant migration in cfz-2 mutants is indistinguishable from wild type (Table 1)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 12 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004991 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A QR cell descendant was scored as defective if its nucleus was posterior to the V2.a nucleus. Because they occupy positions near each other, the data for SDQR and AVM were combined. The position of AQR, a third QR descendant, was not included because it migrates to a location near other nuclei with similar morphology." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Similarly, minor defects in CAN and HSN migration are seen in cfz-2(ok1201) mutants (Fig. 5, Table 1)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_hypomorph_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "An HSN was scored as defective if its nucleus was posterior to the V4 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | kal-1::gfp | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000471 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The ALM cells migrate posteriorly during embryogenesis to occupy a range of final positions between the two hypodermal cells, V2 and V3 (Figs. 1 and 3) (Sulston et al., 1983). In cfz-2(ok1201) mutants, 20% of ALM cells are located anterior to V2 (Fig. 3, Table 1). "By analogy to other mutations in Frizzleds as well as other serpentine receptors, both cfz-2 mutations are predicted to reduce or eliminate gene function (Chen et al., 2004; Heymann and Subramaniam, 1997; Ray et al., 1997; Sawa et al., 1996; Unson et al., 1995). Consistent with this, both mutations are recessive." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 20 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_hypomorph_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "An ALM was scored as anteriorly misplaced (Ant.) if its nucleus was anterior to the V2 nucleus and posteriorly misplaced (Post.) if posterior to the V3 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000625 | Paper_evidence | WBPaper00064204 | |||||||
Curator_confirmed | WBPerson7196 | ||||||||
WBPhenotype:0000883 | Paper_evidence | WBPaper00035405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | cfz-2 mutants had substantial anterior nerve ring defects | Paper_evidence | WBPaper00035405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001761 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "More penetrant was a misrouting defect, where approximately 24% of HSN axons inappropriately crossed the ventral midline to extend anteriorly on the contralateral side (Fig. 6, Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 26 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Axon morphology was examined by indirect immunofluorescence using anti-serotonin antibody (HSN and CP) or two independent GFP-expressing reporter transgenes, ceh-23::gfp and kal-1::gfp (CAN)." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002490 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In cfz-2 mutants, approximately 8% of HSNs extended a second axon, generally from the posterior side (Table 2). The ectopic axons sometimes appeared to merge with the primary axons, after which they entered the VNC (Fig. 6, Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | 8 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Axon morphology was examined by indirect immunofluorescence using anti-serotonin antibody (HSN and CP) or two independent GFP-expressing reporter transgenes, ceh-23::gfp and kal-1::gfp (CAN)." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00044679 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The cfz-2(ok1201) mutation does not affect anteroposterior polarity in the AVG interneuron | Paper_evidence | WBPaper00044679 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003850 | PATO:0000460 | Paper_evidence | WBPaper00044679 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "QL and its descendants migrate posteriorly whereas QR and its descendants migrate anteriorly (Fig. 1; Sulston and Horvitz, 1977). In cfz-2 mutants, the migrations of QR descendants terminated posterior to their normal position 11.8% of the time (Fig. 4, Table 1). QL descendant migration in cfz-2 mutants is indistinguishable from wild type (Table 1)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A QL cell descendant was scored as misplaced anteriorly if its nucleus was anterior to V4.p. Because they occupy positions near each other, the data for SDQL and PVM were combined. The position of PQR, a third QL descendant, was not included because it migrates to a location near other nuclei with similar morphology." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006826 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A BDU was scored as defective if its nucleus was posterior to the V1 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00032196 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were as susceptible to infection by P. aeruginosa as N2 animals. | Paper_evidence | WBPaper00032196 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Strain | WBStrain00031864 | Paper_evidence | WBPaper00032196 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00060654 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There are six Wnt receptors encoded in the C. elegans genome: four Frizzled receptors (LIN-17, CFZ-2, MIG-1 and MOM-5,), one Ror receptor (CAM-1) and one Ryk receptor (LIN-18) (Sawa and Korswagen, 2013). We analyzed the effect of loss-of-function mutations for each receptor and found that loss of cam-1, but not the other receptors, caused defective SMDD axonal development (Figure 1D). | Paper_evidence | WBPaper00060654 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004972 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004971 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00032196 | ||||||||
WBPaper00035405 | |||||||||
WBPaper00026706 | |||||||||
WBPaper00044679 | |||||||||
WBPaper00060654 | |||||||||
WBPaper00064204 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |