WormBase Tree Display for Variation: WBVar00092456
expand all nodes | collapse all nodes | view schema
| WBVar00092456 | Name | Public_name | ok1201 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | CE39149:p.Ile332ValfsTer27 | ||||||||
| F27E11.3.1:c.992_1572del | |||||||||
| HGVSg | CHROMOSOME_V:g.3442059_3443232del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F27E11 | |||||
| Flanking_sequences | caaacagcaaatagcatttttccacgacga | cccaccaaaccgaggcagccattccgaaga | |||||||
| Mapping_target | F27E11 | ||||||||
| Type_of_mutation | Deletion | ||||||||
| PCR_product | OK1201_external | ||||||||
| OK1201_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00008500 | ||||||||
| WBStrain00008502 | |||||||||
| WBStrain00008506 | |||||||||
| WBStrain00031864 | |||||||||
| Laboratory | RB | ||||||||
| Person | WBPerson46 | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000478 | |||||||
| Transcript | F27E11.3.1 (11) | ||||||||
| Interactor (15) | |||||||||
| Isolation | Mutagen | UV/TMP | |||||||
| Genetics | Mapping_data | In_multi_point | 4924 | ||||||
| Description | Phenotype (9) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00044679 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | The cfz-2(ok1201) mutation does not affect anteroposterior polarity in the AVG interneuron | Paper_evidence | WBPaper00044679 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0003850 | PATO:0000460 | Paper_evidence | WBPaper00044679 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000469 | Paper_evidence | WBPaper00026706 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "QL and its descendants migrate posteriorly whereas QR and its descendants migrate anteriorly (Fig. 1; Sulston and Horvitz, 1977). In cfz-2 mutants, the migrations of QR descendants terminated posterior to their normal position 11.8% of the time (Fig. 4, Table 1). QL descendant migration in cfz-2 mutants is indistinguishable from wild type (Table 1)." | Paper_evidence | WBPaper00026706 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Treatment | "A QL cell descendant was scored as misplaced anteriorly if its nucleus was anterior to V4.p. Because they occupy positions near each other, the data for SDQL and PVM were combined. The position of PQR, a third QL descendant, was not included because it migrates to a location near other nuclei with similar morphology." | Paper_evidence | WBPaper00026706 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000594 | Paper_evidence | WBPaper00026706 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table 1 | Paper_evidence | WBPaper00026706 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006826 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Treatment | "A BDU was scored as defective if its nucleus was posterior to the V1 nucleus." | Paper_evidence | WBPaper00026706 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001012 | Paper_evidence | WBPaper00032196 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals were as susceptible to infection by P. aeruginosa as N2 animals. | Paper_evidence | WBPaper00032196 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Strain | WBStrain00031864 | Paper_evidence | WBPaper00032196 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001224 | Paper_evidence | WBPaper00060654 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | There are six Wnt receptors encoded in the C. elegans genome: four Frizzled receptors (LIN-17, CFZ-2, MIG-1 and MOM-5,), one Ror receptor (CAM-1) and one Ryk receptor (LIN-18) (Sawa and Korswagen, 2013). We analyzed the effect of loss-of-function mutations for each receptor and found that loss of cam-1, but not the other receptors, caused defective SMDD axonal development (Figure 1D). | Paper_evidence | WBPaper00060654 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004972 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBbt:0004971 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00032196 | ||||||||
| WBPaper00035405 | |||||||||
| WBPaper00026706 | |||||||||
| WBPaper00044679 | |||||||||
| WBPaper00060654 | |||||||||
| WBPaper00064204 | |||||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
| Method | KO_consortium_allele |
