WormBase Tree Display for Variation: WBVar00093056
expand all nodes | collapse all nodes | view schema
WBVar00093056 | Name | Public_name | ok1859 | ||||
---|---|---|---|---|---|---|---|
Other_name | T13G4.3.1:c.1275_1937-4del | ||||||
T13G4.3.2:c.1275_1937-4del | |||||||
HGVSg | CHROMOSOME_X:g.1170342_1172366del | ||||||
Sequence_details | SMap | S_parent | Sequence | T13G4 | |||
Flanking_sequences | aatggaaaattatcatccgagaaccgcgtt | cagagaccattcaaatgtctgaagcagctc | |||||
Mapping_target | T13G4 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | OK1859_external | ||||||
OK1859_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00032242 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00020490 | |||||
Transcript | T13G4.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | T13G4.3.1:c.1275_1937-4del | ||||||
cDNA_position | 1349-? | ||||||
CDS_position | 1275-? | ||||||
Protein_position | 425-? | ||||||
Intron_number | 11-15/28 | ||||||
Exon_number | 11-15/29 | ||||||
T13G4.3.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | T13G4.3.2:c.1275_1937-4del | ||||||
cDNA_position | 1481-? | ||||||
CDS_position | 1275-? | ||||||
Protein_position | 425-? | ||||||
Intron_number | 12-16/29 | ||||||
Exon_number | 12-16/30 | ||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype | WBPhenotype:0002385 | Paper_evidence | WBPaper00049733 | |||
Curator_confirmed | WBPerson2026 | ||||||
Remark | Figure 2, animals showed defects in sensing the alkaline PH. | Paper_evidence | WBPaper00049733 | ||||
Curator_confirmed | WBPerson2026 | ||||||
Rescued_by_transgene | WBTransgene00025915 | ||||||
WBPhenotype:0004029 | Paper_evidence | WBPaper00064660 | |||||
Curator_confirmed | WBPerson51549 | ||||||
Reference | WBPaper00049733 | ||||||
WBPaper00064660 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |