WormBase Tree Display for Variation: WBVar00142903
expand all nodes | collapse all nodes | view schema
WBVar00142903 | Evidence | Paper_evidence | WBPaper00033138 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e5 | |||||
Other_name (21) | |||||||
HGVSg | CHROMOSOME_X:g.15124688G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | R07D5 | |||
Flanking_sequences | tccacgtgaaatttattcgcgtagaaatcga | aaattggctattaccaatgggtgccgtttat | |||||
Mapping_target | R07D5 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00033138 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (4) | |||||||
Laboratory | CB | ||||||
OJ | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00006747 | |||||
Transcript (11) | |||||||
Interactor | WBInteraction000518923 | ||||||
WBInteraction000518930 | |||||||
Isolation | Mutagen | EMS | |||||
Genetics | Interpolated_map_position | X | 22.0113 | ||||
Mapping_data | In_2_point | 494 | |||||
3170 | |||||||
3636 | |||||||
6060 | |||||||
6165 | |||||||
In_multi_point (6) | |||||||
Description | Phenotype (31) | ||||||
Phenotype_not_observed | WBPhenotype:0000637 | Paper_evidence | WBPaper00000214 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000641 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | active, healthy, e5/Df similar, null phenotype. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Null | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000672 | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | The synaptic vesicle markers (SNB-1::GFP and SNG-1::GFP) showed normal morphology, as well as normal number and distribution of dorsal or lateral cord puncta in unc-7 animals | Paper_evidence | WBPaper00033075 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00033075 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0001323 | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | The synaptic vesicle markers (SNB-1::GFP and SNG-1::GFP) showed normal morphology, as well as normal number and distribution of dorsal or lateral cord puncta in unc-7 animals | Paper_evidence | WBPaper00033075 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00033075 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0001669 | Paper_evidence | WBPaper00033075 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | The synaptic vesicle markers (SNB-1::GFP and SNG-1::GFP) showed normal morphology, as well as normal number and distribution of dorsal or lateral cord puncta in unc-7 animals | Paper_evidence | WBPaper00033075 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00033075 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0002014 | Paper_evidence | WBPaper00027055 | |||||
Curator_confirmed | WBPerson557 | ||||||
Remark | unc-7(e5) did not inhibit the electrical coupling of body wall muscle cells. | Paper_evidence | WBPaper00027055 | ||||
Curator_confirmed | WBPerson557 | ||||||
Reference (11) | |||||||
Method | Substitution_allele |