WormBase Tree Display for Variation: WBVar00142933
expand all nodes | collapse all nodes | view schema
WBVar00142933 | Evidence | Paper_evidence | WBPaper00002646 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e49 | |||||||
Other_name | n49 | Paper_evidence | WBPaper00043983 | ||||||
CE04840:p.Ala546Thr | |||||||||
CE48967:p.Ala585Thr | |||||||||
CE49123:p.Ala587Thr | |||||||||
R13A1.4c.1:c.1759G>A | |||||||||
R13A1.4a.1:c.1756G>A | |||||||||
CE26381:p.Ala586Thr | |||||||||
R13A1.4b.1:c.1753G>A | |||||||||
R13A1.4d.1:c.1636G>A | |||||||||
HGVSg | CHROMOSOME_IV:g.7202315G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | R13A1 | |||||
Flanking_sequences | ctaccatctgaagagcatagacattgtaat | cgaagtcaaaaattgatcgttagttttttt | |||||||
Mapping_target | R13A1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002646 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00006748 | |||||||
Transcript | R13A1.4d.1 (12) | ||||||||
R13A1.4c.1 (12) | |||||||||
R13A1.4a.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0.02 | deleterious | |||||||
PolyPhen | 0.651 | possibly_damaging | |||||||
HGVSc | R13A1.4a.1:c.1756G>A | ||||||||
HGVSp | CE26381:p.Ala586Thr | ||||||||
cDNA_position | 1756 | ||||||||
CDS_position | 1756 | ||||||||
Protein_position | 586 | ||||||||
Exon_number | 16/21 | ||||||||
Codon_change | Gcg/Acg | ||||||||
Amino_acid_change | A/T | ||||||||
R13A1.4b.1 (12) | |||||||||
Genetics | Interpolated_map_position | IV | 3.29389 | ||||||
Mapping_data | In_2_point | 107 | |||||||
In_multi_point | 115 | ||||||||
116 | |||||||||
382 | |||||||||
484 | |||||||||
490 | |||||||||
495 | |||||||||
509 | |||||||||
569 | |||||||||
592 | |||||||||
624 | |||||||||
626 | |||||||||
685 | |||||||||
737 | |||||||||
738 | |||||||||
747 | |||||||||
772 | |||||||||
913 | |||||||||
914 | |||||||||
1116 | |||||||||
1128 | |||||||||
1131 | |||||||||
1133 | |||||||||
1136 | |||||||||
1297 | |||||||||
In_pos_neg_data | 2737 | ||||||||
3701 | |||||||||
5318 | |||||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | kinks both forward and backward | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Moves well but slowly and irregularly, e49/+ very slightly uncoordinated. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001331 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | swollen ventral cord motor neurons | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005829 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (12) | |||||||||
Remark | n49 is a typo of e49 | Paper_evidence | WBPaper00043983 | ||||||
Method | Substitution_allele |