WormBase Tree Display for Variation: WBVar00142935
expand all nodes | collapse all nodes | view schema
WBVar00142935 | Name (3) | ||||||||
---|---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | C44E1 | |||||
Flanking_sequences | AAGATGACACTCACCAATATGATGAAGTTGATCGTGGATCC | GAGTATCTTTCACAAGAACACCATCAGTAGATAGAACAG | |||||||
Mapping_target | C44E1 | ||||||||
Type_of_mutation | Substitution | C | T | Person_evidence | WBPerson26471 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Engineered_allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (64) | |||||||||
Laboratory | CB | ||||||||
KR | |||||||||
NCA | |||||||||
Person | WBPerson26471 | ||||||||
Status | Live | ||||||||
Linked_to | WBVar02146566 | ||||||||
Affects | Gene | WBGene00006752 | |||||||
Transcript | ZK524.2e.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2e.1:c.1411C>T | ||||||||
HGVSp | CE34626:p.Arg471Ter | ||||||||
cDNA_position | 1411 | ||||||||
CDS_position | 1411 | ||||||||
Protein_position | 471 | ||||||||
Exon_number | 11/30 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
ZK524.2c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2c.1:c.388C>T | ||||||||
HGVSp | CE34624:p.Arg130Ter | ||||||||
cDNA_position | 388 | ||||||||
CDS_position | 388 | ||||||||
Protein_position | 130 | ||||||||
Exon_number | 3/22 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
ZK524.2f.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2f.1:c.1420C>T | ||||||||
HGVSp | CE43866:p.Arg474Ter | ||||||||
cDNA_position | 1420 | ||||||||
CDS_position | 1420 | ||||||||
Protein_position | 474 | ||||||||
Exon_number | 11/30 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
ZK524.2j.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2j.1:c.1375C>T | ||||||||
HGVSp | CE51718:p.Arg459Ter | ||||||||
cDNA_position | 1375 | ||||||||
CDS_position | 1375 | ||||||||
Protein_position | 459 | ||||||||
Exon_number | 11/29 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
ZK524.2k.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2k.1:c.1366C>T | ||||||||
HGVSp | CE51726:p.Arg456Ter | ||||||||
cDNA_position | 1366 | ||||||||
CDS_position | 1366 | ||||||||
Protein_position | 456 | ||||||||
Exon_number | 11/29 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
ZK524.2a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2a.1:c.1411C>T | ||||||||
HGVSp | CE15371:p.Arg471Ter | ||||||||
cDNA_position | 1411 | ||||||||
CDS_position | 1411 | ||||||||
Protein_position | 471 | ||||||||
Exon_number | 11/30 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
ZK524.2i.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2i.1:c.1420C>T | ||||||||
HGVSp | CE32552:p.Arg474Ter | ||||||||
cDNA_position | 1420 | ||||||||
CDS_position | 1420 | ||||||||
Protein_position | 474 | ||||||||
Exon_number | 11/29 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
ZK524.2d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2d.1:c.1411C>T | ||||||||
HGVSp | CE34625:p.Arg471Ter | ||||||||
cDNA_position | 1411 | ||||||||
CDS_position | 1411 | ||||||||
Protein_position | 471 | ||||||||
Exon_number | 11/31 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
ZK524.2h.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2h.1:c.388C>T | ||||||||
HGVSp | CE51759:p.Arg130Ter | ||||||||
cDNA_position | 388 | ||||||||
CDS_position | 388 | ||||||||
Protein_position | 130 | ||||||||
Exon_number | 3/21 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor | WBInteraction000518950 | ||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | I | 2.07389 | ||||||
Mapping_data | In_2_point (20) | ||||||||
In_multi_point (87) | |||||||||
In_pos_neg_data | 466 | ||||||||
470 | |||||||||
2514 | |||||||||
5851 | |||||||||
5853 | |||||||||
5963 | |||||||||
8066 | |||||||||
8086 | |||||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000017 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ric | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000020 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00058720 | |||||||
Curator_confirmed | WBPerson26471 | ||||||||
WBPhenotype:0000180 | Paper_evidence | WBPaper00006029 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 71/168 adult animals showed defects as visualized by unc-47::GFP. | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004822 | PATO:0000460 | Paper_evidence | WBPaper00006029 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000229 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Localization of the synaptic protein SNB-1 is weakly abnormal, based on expression analysis of SNB-1::VENUS. | Paper_evidence | WBPaper00028886 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000507 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | high acetylcholine levels | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000604 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | variable neuroanatomical defects | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000634 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | pharyngeal movement irregular. | Paper_evidence | WBPaper00000031 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00000031 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00004117 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Increased levels of protein degradation in muscle in response to starvation | Paper_evidence | WBPaper00004117 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
WBPhenotype:0002490 | Paper_evidence | WBPaper00006029 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 71/168 adult animals showed defects as visualized by unc-47::GFP. | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004822 | PATO:0000460 | Paper_evidence | WBPaper00006029 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000640 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | able to lay eggs | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00030754 | |||||||
WBPaper00004883 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | as measured by fluorescence levels of ANF::GFP in coelomocytes | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | EG3683 unc-13(e51) oxIs206[Paex-3:ANF::GFP] | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | ||||||||
arIs37 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001512 | Paper_evidence | WBPaper00031992 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ON-OFF asymmetry of ASEL and ASER was preserved in each of these animals. | Paper_evidence | WBPaper00031992 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (29) | |||||||||
Remark | Old Mapping_target ZK524 updated based on the VEP analysis pipeline to C44E1. | ||||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006752 Opal_UGA R to STOP | Person_evidence | WBPerson26471" | |||||||
WBPerson26471 | |||||||||
Method | Substitution_allele |