WormBase Tree Display for Variation: WBVar00142938
expand all nodes | collapse all nodes | view schema
WBVar00142938 | Evidence | Paper_evidence | WBPaper00006005 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e55 | ||||||
Other_name | T02C5.5p.1:c.1804C>T | |||||||
T02C5.5o.1:c.1648C>T | ||||||||
CE51886:p.Gln488Ter | ||||||||
T02C5.5k.1:c.1267C>T | ||||||||
CE51879:p.Gln488Ter | ||||||||
T02C5.5h.1:c.1462C>T | ||||||||
T02C5.5m.1:c.1267C>T | ||||||||
T02C5.5g.1:c.1462C>T | ||||||||
T02C5.5j.1:c.1267C>T | ||||||||
CE34980:p.Gln458Ter | ||||||||
T02C5.5f.1:c.1462C>T | ||||||||
CE52764:p.Gln550Ter | ||||||||
CE52692:p.Gln602Ter | ||||||||
CE51900:p.Gln332Ter | ||||||||
CE51899:p.Gln332Ter | ||||||||
CE51867:p.Gln423Ter | ||||||||
CE51907:p.Gln488Ter | ||||||||
T02C5.5i.1:c.1462C>T | ||||||||
T02C5.5b.1:c.1372C>T | ||||||||
CE52709:p.Gln416Ter | ||||||||
CE51857:p.Gln423Ter | ||||||||
CE51839:p.Gln423Ter | ||||||||
T02C5.5n.1:c.1672C>T | ||||||||
T02C5.5q.1:c.1246C>T | ||||||||
CE52755:p.Gln558Ter | ||||||||
T02C5.5c.1:c.994C>T | ||||||||
CE51856:p.Gln423Ter | ||||||||
CE51840:p.Gln488Ter | ||||||||
T02C5.5a.1:c.994C>T | ||||||||
T02C5.5l.1:c.1267C>T | ||||||||
HGVSg | CHROMOSOME_X:g.2723343G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | T02C5 | ||||
Flanking_sequences | agacggcgagccgctaataaaaagttaaaa | aagcctcaaaacagcagtctacagaaactg | ||||||
Mapping_target | T02C5 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00006005 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004087 | |||||||
WBStrain00004519 | ||||||||
WBStrain00005534 | ||||||||
WBStrain00005535 | ||||||||
WBStrain00005536 | ||||||||
WBStrain00008428 | ||||||||
WBStrain00027630 | ||||||||
WBStrain00029947 | ||||||||
WBStrain00030697 | ||||||||
WBStrain00030826 | ||||||||
WBStrain00034256 | ||||||||
WBStrain00035027 | ||||||||
WBStrain00035127 | ||||||||
WBStrain00035128 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006742 | ||||||
Transcript (15) | ||||||||
Interactor | WBInteraction000052099 | |||||||
WBInteraction000052101 | ||||||||
WBInteraction000501477 | ||||||||
WBInteraction000501479 | ||||||||
WBInteraction000502185 | ||||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | X | -13.8024 | |||||
Mapping_data | In_2_point | 154 | ||||||
3151 | ||||||||
In_multi_point (14) | ||||||||
In_pos_neg_data (18) | ||||||||
Description | Phenotype (16) | |||||||
Phenotype_not_observed | WBPhenotype:0001182 | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants had wild-type fat content | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Fat content was visualized by Nile red staining | Paper_evidence | WBPaper00031915 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 and gcy-7 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6, otIs3 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001811 | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants were susceptible to the fat-reducing effects of exogenously administered serotonin | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Reduced fat content of 5-HT-treated animals was visualized by Nile red staining and confirmed by thin-layer chromatography (TLC) quantitation of total triglycerides extracted from vehicle- and 5-HT-treated worms and by Sudan black fat staining | Paper_evidence | WBPaper00031915 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (21) | ||||||||
Remark | Resequencing of e55 places the lesion at Q(458) (in isoform T02C5.5b) with flanks of agacggcgagccgctaataaaaagttaaaa & aagcctcaaaacagcagtctacagaaactg | Person_evidence | WBPerson12335 | |||||
Laboratory_evidence | KG | |||||||
Following genotyping from the CGC we are updating the flanking sequences to follow both the reported update from 2011 and those now supplied by the CGC. Old flanks [tgttgccattcagttggaaaattcatcaaa aactgaggtaagaataaataatagtgtttt]. | Person_evidence | WBPerson2207 | ||||||
Curator_confirmed | WBPerson1983 | |||||||
Method | Substitution_allele |