WormBase Tree Display for Variation: WBVar00142958
expand all nodes | collapse all nodes | view schema
WBVar00142958 | Evidence | Paper_evidence | WBPaper00003843 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e96 | |||||||
Other_name | Y37E11AR.6b.1:c.478C>T | ||||||||
Y37E11AR.6a.1:c.793C>T | |||||||||
CE27606:p.Arg265Ter | |||||||||
CE48555:p.Arg160Ter | |||||||||
HGVSg | CHROMOSOME_IV:g.3761479G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y37E11AR | |||||
Flanking_sequences | gaatctctgtactcatcatctggacggctc | gatatgtgctcctactgccggctctcctgc | |||||||
Mapping_target | Y37E11AR | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003843 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (2) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006869 | |||||||
Transcript (2) | |||||||||
Interactor | WBInteraction000519472 | ||||||||
Genetics | Interpolated_map_position | IV | -2.30737 | ||||||
Mapping_data | In_multi_point | 52 | |||||||
127 | |||||||||
906 | |||||||||
1561 | |||||||||
2009 | |||||||||
3241 | |||||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % animals paralyzed after 60 min on 1mM aldicarb was significantly higher than % N2 animals paralyzed. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00031872 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000071 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000379 | Paper_evidence | WBPaper00000031 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Notched head, especially in L1; resembles vab-1 alleles; penetrance 65%. Easy to impossible to score (ES3/0). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | variable penetrance | Paper_evidence | WBPaper00000031 | |||||
Curator_confirmed | WBPerson48 | ||||||||
65% | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002045 | Paper_evidence | WBPaper00040629 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Germ-cell corpse quantification in mutants show a strong germ-cell death defect, similar to vab-1/EphR-null mutants. | Paper_evidence | WBPaper00040629 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000247 | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000254 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040629 | ||||||||
WBPaper00031872 | |||||||||
WBPaper00001328 | |||||||||
WBPaper00000031 | |||||||||
WBPaper00000214 | |||||||||
Method | Substitution_allele |