WormBase Tree Display for Variation: WBVar00142961
expand all nodes | collapse all nodes | view schema
WBVar00142961 | Evidence | Paper_evidence | WBPaper00004891 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e102 | |||||
Other_name | T10A3.1a.1:c.2207+1G>A | ||||||
T10A3.1d.1:c.2162+1G>A | |||||||
T10A3.1f.1:c.2162+1G>A | |||||||
T10A3.1b.1:c.2207+1G>A | |||||||
T10A3.1e.1:c.2168+1G>A | |||||||
T10A3.1c.1:c.2168+1G>A | |||||||
HGVSg | CHROMOSOME_X:g.7275968C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | T10A3 | |||
Flanking_sequences | tgtcgagctgattgttagtaggagtgcaat | taaatatacattttatttttaaactctgtc | |||||
Mapping_target | T10A3 | ||||||
Type_of_mutation | Substitution | g | a | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004100 | ||||||
WBStrain00005508 | |||||||
WBStrain00005509 | |||||||
WBStrain00027194 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006750 | |||||
Transcript (6) | |||||||
Isolation | Mutagen | EMS | |||||
Genetics | Interpolated_map_position | X | -1.78183 | ||||
Mapping_data | In_2_point | 147 | |||||
182 | |||||||
3912 | |||||||
3913 | |||||||
6198 | |||||||
In_multi_point | 164 | ||||||
647 | |||||||
1218 | |||||||
1336 | |||||||
1583 | |||||||
1740 | |||||||
2211 | |||||||
2215 | |||||||
2289 | |||||||
2454 | |||||||
2455 | |||||||
2471 | |||||||
3244 | |||||||
In_pos_neg_data (13) | |||||||
Description | Phenotype (30) | ||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00028886 | ||||
Curator_confirmed | WBPerson48 | ||||||
Remark | Localization of the synaptic protein SNB-1 is normal, based on expression analysis of SNB-1::VENUS. | Paper_evidence | WBPaper00028886 | ||||
Curator_confirmed | WBPerson48 | ||||||
Reference | WBPaper00043908 | ||||||
WBPaper00035074 | |||||||
WBPaper00001709 | |||||||
WBPaper00028886 | |||||||
WBPaper00015500 | |||||||
WBPaper00000031 | |||||||
WBPaper00002487 | |||||||
WBPaper00015253 | |||||||
WBPaper00045955 | |||||||
WBPaper00048427 | |||||||
Method | Substitution_allele |