WormBase Tree Display for Variation: WBVar00143004
expand all nodes | collapse all nodes | view schema
| WBVar00143004 | Evidence | Person_evidence | WBPerson261 | ||
|---|---|---|---|---|---|
| WBPerson2629 | |||||
| Name | Public_name | e164 | |||
| Other_name | CE11066:p.Gln189Ter | ||||
| F54D8.1.1:c.565C>T | |||||
| HGVSg | CHROMOSOME_III:g.5107949C>T | ||||
| Sequence_details | SMap | S_parent | Sequence | F54D8 | |
| Flanking_sequences | gacggagaagatgctgatgatgccaaggct | agactcaacaatacgatggatgcttcactt | |||
| Mapping_target | F54D8 | ||||
| Type_of_mutation | Substitution | c | t | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain (201) | |||||
| Laboratory | CB | ||||
| UP | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00001076 | |||
| Transcript | F54D8.1.1 | VEP_consequence | stop_gained | ||
| VEP_impact | HIGH | ||||
| HGVSc | F54D8.1.1:c.565C>T | ||||
| HGVSp | CE11066:p.Gln189Ter | ||||
| cDNA_position | 568 | ||||
| CDS_position | 565 | ||||
| Protein_position | 189 | ||||
| Exon_number | 3/4 | ||||
| Codon_change | Cag/Tag | ||||
| Amino_acid_change | Q/* | ||||
| Interactor | WBInteraction000502314 | ||||
| WBInteraction000537325 | |||||
| Genetics | Interpolated_map_position | III | -2.13511 | ||
| Mapping_data | In_2_point (29) | ||||
| In_multi_point (150) | |||||
| In_pos_neg_data | 1578 | ||||
| 1582 | |||||
| 1586 | |||||
| 1596 | |||||
| 1616 | |||||
| 3244 | |||||
| Description (2) | |||||
| Reference (20) | |||||
| Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||
| Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
| Method | Substitution_allele |
