WormBase Tree Display for Variation: WBVar00143019
expand all nodes | collapse all nodes | view schema
WBVar00143019 | Evidence | Paper_evidence | WBPaper00005152 | ||
---|---|---|---|---|---|
WBPaper00005325 | |||||
Name | Public_name | e185 | |||
Other_name | CE54061:p.Cys185Tyr | ||||
F48E8.1a.1:c.554G>A | |||||
F48E8.1c.1:c.554G>A | |||||
CE01953:p.Cys185Tyr | |||||
F48E8.1b.1:c.554G>A | |||||
CE29046:p.Cys185Tyr | |||||
HGVSg | CHROMOSOME_III:g.5476405G>A | ||||
Sequence_details | SMap | S_parent | Sequence | F48E8 | |
Flanking_sequences | ttgtctgggcaaagacgaatctcgtcggat | cggcttctcccgttgccgtgacgttcaggg | |||
Mapping_target | F48E8 | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain (17) | |||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00003055 | |||
Transcript (3) | |||||
Interactor | WBInteraction000009116 | ||||
WBInteraction000503035 | |||||
WBInteraction000537301 | |||||
Genetics | Interpolated_map_position | III | -1.62777 | ||
Mapping_data | In_2_point | 276 | |||
579 | |||||
2725 | |||||
3796 | |||||
3797 | |||||
5516 | |||||
6014 | |||||
7160 | |||||
In_multi_point (62) | |||||
In_pos_neg_data | 803 | ||||
1590 | |||||
Description (2) | |||||
Reference (12) | |||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
Method | Substitution_allele |