WormBase Tree Display for Variation: WBVar00143034
expand all nodes | collapse all nodes | view schema
WBVar00143034 | Evidence | Paper_evidence | WBPaper00026866 | |||||
---|---|---|---|---|---|---|---|---|
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | M57 | ||||
Flanking_sequences | gcgggaaagctcgcccttcccgccggaatc | atgtctacactcaggtcaccgattcttccg | ||||||
Mapping_target | M57 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00026866 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (13) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006769 | ||||||
Transcript | Y37E11C.1c.1 (12) | |||||||
Y37E11C.1b.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | |||||||
SIFT | 0 | deleterious | ||||||
PolyPhen | 1 | probably_damaging | ||||||
HGVSc | Y37E11C.1b.1:c.640G>A | |||||||
HGVSp | CE31638:p.Asp214Asn | |||||||
cDNA_position | 640 | |||||||
CDS_position | 640 | |||||||
Protein_position | 214 | |||||||
Exon_number | 4/6 | |||||||
Codon_change | Gat/Aat | |||||||
Amino_acid_change | D/N | |||||||
Y37E11C.1a.1 (12) | ||||||||
Interactor | WBInteraction000569521 | |||||||
Genetics | Interpolated_map_position | IV | -3.30051 | |||||
Mapping_data | In_2_point | 99 | ||||||
448 | ||||||||
484 | ||||||||
1643 | ||||||||
3276 | ||||||||
In_multi_point (13) | ||||||||
Description | Phenotype (13) | |||||||
Phenotype_not_observed | WBPhenotype:0000351 | Paper_evidence | WBPaper00060038 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "As expected for a negative control, the empty feeding vector (L4440) fed to either wildtype or unc-33(e204) homozygous animals showed a low level of lethality, 3.4% and 9.3% on average, respectively. These data were not significantly different from each other in a pairwise comparison (p=0.872)." | Paper_evidence | WBPaper00060038 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Strain | WBStrain00004126 | Paper_evidence | WBPaper00060038 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00060038 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants showed normal localization of SNB-1::VENUS in the RIA neuron. | Paper_evidence | WBPaper00040857 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | PKD-2::GFP localization is not different from wild type. | Paper_evidence | WBPaper00028448 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 and gcy-7 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6, otIs3 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (14) | ||||||||
Method | Substitution_allele |