WormBase Tree Display for Variation: WBVar00143034
expand all nodes | collapse all nodes | view schema
WBVar00143034 | Evidence | Paper_evidence | WBPaper00026866 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e204 | ||||||
Other_name | Y37E11C.1b.1:c.640G>A | |||||||
Y37E11C.1c.1:c.172G>A | ||||||||
CE31638:p.Asp214Asn | ||||||||
CE31639:p.Asp58Asn | ||||||||
CE21557:p.Asp389Asn | ||||||||
Y37E11C.1a.1:c.1165G>A | ||||||||
HGVSg | CHROMOSOME_IV:g.3523049G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | M57 | ||||
Flanking_sequences | gcgggaaagctcgcccttcccgccggaatc | atgtctacactcaggtcaccgattcttccg | ||||||
Mapping_target | M57 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00026866 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (4) | ||||||||
Affects | Gene | WBGene00006769 | ||||||
Transcript | Y37E11C.1c.1 (12) | |||||||
Y37E11C.1b.1 (12) | ||||||||
Y37E11C.1a.1 (12) | ||||||||
Interactor | WBInteraction000569521 | |||||||
Genetics | Interpolated_map_position | IV | -3.30051 | |||||
Mapping_data | In_2_point | 99 | ||||||
448 | ||||||||
484 | ||||||||
1643 | ||||||||
3276 | ||||||||
In_multi_point (13) | ||||||||
Description | Phenotype (13) | |||||||
Phenotype_not_observed | WBPhenotype:0000351 | Paper_evidence | WBPaper00060038 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "As expected for a negative control, the empty feeding vector (L4440) fed to either wildtype or unc-33(e204) homozygous animals showed a low level of lethality, 3.4% and 9.3% on average, respectively. These data were not significantly different from each other in a pairwise comparison (p=0.872)." | Paper_evidence | WBPaper00060038 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Strain | WBStrain00004126 | Paper_evidence | WBPaper00060038 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00060038 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants showed normal localization of SNB-1::VENUS in the RIA neuron. | Paper_evidence | WBPaper00040857 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | PKD-2::GFP localization is not different from wild type. | Paper_evidence | WBPaper00028448 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 and gcy-7 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6, otIs3 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (14) | ||||||||
Method | Substitution_allele |