WormBase Tree Display for Variation: WBVar00143063
expand all nodes | collapse all nodes | view schema
| WBVar00143063 | Evidence | Paper_evidence | WBPaper00031175 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e251 | |||||||
| Other_name | CE24860:p.Trp452Ter | ||||||||
| C50C3.9c.1:c.1355G>A | |||||||||
| CE32168:p.Trp496Ter | |||||||||
| C50C3.9a.1:c.1487G>A | |||||||||
| HGVSg | CHROMOSOME_III:g.8197512C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C50C3 | |||||
| Flanking_sequences | cattataaagaatctggacaattatcttggt | gactggagtttacagagaaagattggtgagt | |||||||
| Mapping_target | C50C3 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031175 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain (67) | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006772 | |||||||
| Transcript | C50C3.9a.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C50C3.9a.1:c.1487G>A | ||||||||
| HGVSp | CE32168:p.Trp496Ter | ||||||||
| cDNA_position | 1588 | ||||||||
| CDS_position | 1487 | ||||||||
| Protein_position | 496 | ||||||||
| Exon_number | 9/18 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| C50C3.9c.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C50C3.9c.1:c.1355G>A | ||||||||
| HGVSp | CE24860:p.Trp452Ter | ||||||||
| cDNA_position | 1467 | ||||||||
| CDS_position | 1355 | ||||||||
| Protein_position | 452 | ||||||||
| Exon_number | 8/17 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| Interactor | WBInteraction000052098 | ||||||||
| WBInteraction000052102 | |||||||||
| WBInteraction000502423 | |||||||||
| WBInteraction000502424 | |||||||||
| Genetics | Interpolated_map_position | III | -0.373497 | ||||||
| Mapping_data | In_2_point (12) | ||||||||
| In_multi_point | 76 | ||||||||
| 368 | |||||||||
| 369 | |||||||||
| 370 | |||||||||
| 376 | |||||||||
| 377 | |||||||||
| 378 | |||||||||
| 379 | |||||||||
| 389 | |||||||||
| 406 | |||||||||
| 409 | |||||||||
| 412 | |||||||||
| 428 | |||||||||
| 429 | |||||||||
| 430 | |||||||||
| 559 | |||||||||
| 756 | |||||||||
| 872 | |||||||||
| 874 | |||||||||
| 877 | |||||||||
| 878 | |||||||||
| 1093 | |||||||||
| 1100 | |||||||||
| 1101 | |||||||||
| 1109 | |||||||||
| 1110 | |||||||||
| 1113 | |||||||||
| 1397 | |||||||||
| 1403 | |||||||||
| 1405 | |||||||||
| 1406 | |||||||||
| 1407 | |||||||||
| 1410 | |||||||||
| 1411 | |||||||||
| 1413 | |||||||||
| 1417 | |||||||||
| 1419 | |||||||||
| 1484 | |||||||||
| 1486 | |||||||||
| 1494 | |||||||||
| 1623 | |||||||||
| 1624 | |||||||||
| 1634 | |||||||||
| 1639 | |||||||||
| 1662 | |||||||||
| 1667 | |||||||||
| 1753 | |||||||||
| 1755 | |||||||||
| 1886 | |||||||||
| 1903 | |||||||||
| 1904 | |||||||||
| 1907 | |||||||||
| 2056 | |||||||||
| 2104 | |||||||||
| 2130 | |||||||||
| 2178 | |||||||||
| 2180 | |||||||||
| 2181 | |||||||||
| 2182 | |||||||||
| 2186 | |||||||||
| 2187 | |||||||||
| 2188 | |||||||||
| 2189 | |||||||||
| 2217 | |||||||||
| 2242 | |||||||||
| 2243 | |||||||||
| 2247 | |||||||||
| 2743 | |||||||||
| 2761 | |||||||||
| 3167 | |||||||||
| 3168 | |||||||||
| 3169 | |||||||||
| 3170 | |||||||||
| 3175 | |||||||||
| 3178 | |||||||||
| 3191 | |||||||||
| 3192 | |||||||||
| 3297 | |||||||||
| 3298 | |||||||||
| 3299 | |||||||||
| 3300 | |||||||||
| 3301 | |||||||||
| 3302 | |||||||||
| 3305 | |||||||||
| 3306 | |||||||||
| 3387 | |||||||||
| In_pos_neg_data | 807 | ||||||||
| 818 | |||||||||
| 1617 | |||||||||
| 3807 | |||||||||
| Description | Phenotype | WBPhenotype:0000001 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | loopy at rest | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000017 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Ric | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000019 | Paper_evidence | WBPaper00001709 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000020 | Paper_evidence | WBPaper00001709 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000022 | Paper_evidence | WBPaper00001709 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000023 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | hypersensitive to serotonin | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000164 | Paper_evidence | WBPaper00001709 | |||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPerson712 | |||||||||
| WBPhenotype:0000325 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | increased sensitivity to arecoline | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000334 | Paper_evidence | WBPaper00001709 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Bacteria in the corpus and isthmus are not efficiently moved posteriorly during pharyngeal pumping | Paper_evidence | WBPaper00001709 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0003734 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBbt:0003733 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000515 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | normal ventral nerve cord ultrastructure | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000557 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | fails to adapt to dopamine (like Unc-2) | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000559 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | hypersensitive to calcium channel modulators such as verapamil | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Affected_by | Molecule | WBMol:00004892 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000565 | Paper_evidence | WBPaper00001709 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000616 | Paper_evidence | WBPaper00042396 | |||||||
| Curator_confirmed | WBPerson1687 | ||||||||
| Remark | GABAergic neuromuscular junctions (NMJs) are enlarged | Paper_evidence | WBPaper00042396 | ||||||
| Curator_confirmed | WBPerson1687 | ||||||||
| Recessive | Paper_evidence | WBPaper00042396 | |||||||
| Curator_confirmed | WBPerson1687 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00042396 | ||||||
| Curator_confirmed | WBPerson1687 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005190 | PATO:0000460 | Paper_evidence | WBPaper00042396 | ||||
| Curator_confirmed | WBPerson1687 | ||||||||
| GO_term | GO:0050808 | PATO:0000460 | Paper_evidence | WBPaper00042396 | |||||
| Curator_confirmed | WBPerson1687 | ||||||||
| GO:0045202 | PATO:0000460 | Paper_evidence | WBPaper00042396 | ||||||
| Curator_confirmed | WBPerson1687 | ||||||||
| WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPhenotype:0000644 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | almost paralysed | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000646 | Paper_evidence | WBPaper00001709 | |||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPerson712 | |||||||||
| Remark | very slow | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001512 | Paper_evidence | WBPaper00029404 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals express str-2::GFP in both AWC cells, e.g. both AWC neurons have are AWC on (n=186). | Paper_evidence | WBPaper00029404 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Penetrance | High | Paper_evidence | WBPaper00029404 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00029404 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBbt:0005832 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBbt:0005833 | PATO:0000460 | Paper_evidence | WBPaper00029404 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | str-2::GFP | Paper_evidence | WBPaper00029404 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001622 | Paper_evidence | WBPaper00002487 | |||||||
| Curator_confirmed | WBPerson554 | ||||||||
| Remark | Figure 3 | Paper_evidence | WBPaper00002487 | ||||||
| Curator_confirmed | WBPerson554 | ||||||||
| Affected_by | Molecule | WBMol:00004929 | Paper_evidence | WBPaper00002487 | |||||
| Curator_confirmed | WBPerson554 | ||||||||
| WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
| WBPaper00044621 | |||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPerson6538 | |||||||||
| Remark | Mutants are defective in str-2 asymmetry | Paper_evidence | WBPaper00003760 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Fig 4, 5. Loss of AWC asymmetry | Paper_evidence | WBPaper00044621 | |||||||
| Curator_confirmed | WBPerson6538 | ||||||||
| Penetrance | High | Paper_evidence | WBPaper00044621 | ||||||
| Curator_confirmed | WBPerson6538 | ||||||||
| Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00044621 | ||||||
| Curator_confirmed | WBPerson6538 | ||||||||
| Probable_null_via_phenotype | Paper_evidence | WBPaper00003760 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003760 | ||||
| WBPaper00044621 | |||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPerson6538 | |||||||||
| Phenotype_not_observed | WBPhenotype:0001182 | Paper_evidence | WBPaper00031915 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mutants had wild-type fat content | Paper_evidence | WBPaper00031915 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Fat content was visualized by Nile red staining | Paper_evidence | WBPaper00031915 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table 1 | Paper_evidence | WBPaper00040284 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001811 | Paper_evidence | WBPaper00031915 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mutants were susceptible to the fat-reducing effects of exogenously administered serotonin | Paper_evidence | WBPaper00031915 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Reduced fat content of 5-HT-treated animals was visualized by Nile red staining and confirmed by thin-layer chromatography (TLC) quantitation of total triglycerides extracted from vehicle- and 5-HT-treated worms and by Sudan black fat staining | Paper_evidence | WBPaper00031915 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference (30) | |||||||||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006772 Amber_UAG_or_Opal_UGA | ||||||||
| Method | Substitution_allele |
