WormBase Tree Display for Variation: WBVar00143068
expand all nodes | collapse all nodes | view schema
WBVar00143068 | Name | Public_name | e257 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE37921:p.Arg203Gln | |||||||
F56A12.1.1:c.608G>A | ||||||||
HGVSg | CHROMOSOME_V:g.14374936G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F56A12 | ||||
Flanking_sequences | gcaaagaactgaatccagtggaaaaatatc | gctgagacgaaagtttccggctccgaaaac | ||||||
Mapping_target | F56A12 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00050496 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004136 | |||||||
WBStrain00005888 | ||||||||
WBStrain00006218 | ||||||||
WBStrain00027367 | ||||||||
WBStrain00033528 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects (2) | ||||||||
Genetics | Interpolated_map_position | V | 6.28204 | |||||
Mapping_data (3) | ||||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | fairly severe kinker, e257/Df more severe phenotypes | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000093 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 15% of hermaphrodites have third gonad arm arising from additional somatic gonad founder, "Z5". e257/Df more severe phenotypes. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000230 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | often withered tail as a result of 80% CAN migration defect; e257/Df more severe phenotypes. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000232 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | often withered tail as a result of 80% CAN migration defect; e257/Df more severe phenotypes. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000583 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | slightly dumpy; e257/Df more severe phenotypes. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000594 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | migrations other than CAN also variably defective. e257/Df more severe phenotypes. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | ||||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0001928 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 15% of hermaphrodites have third gonad arm arising from additional somatic gonad founder, "Z5". e257/Df more severe phenotypes. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000641 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | fairly active | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Disease_info | Models_disease | DOID:14702 | ||||||
Models_disease_in_annotation | WBDOannot00000238 | |||||||
Reference | WBPaper00032446 | |||||||
WBPaper00000031 | ||||||||
WBPaper00004883 | ||||||||
WBPaper00016590 | ||||||||
WBPaper00015049 | ||||||||
WBPaper00050496 | ||||||||
Method | Substitution_allele |