WormBase Tree Display for Variation: WBVar00143101
expand all nodes | collapse all nodes | view schema
WBVar00143101 | Evidence | Paper_evidence | WBPaper00031010 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | T07A5 | |||
Flanking_sequences | acggaaagttcgtgaccaggacgtcgagtg | ggttattgcttcgatgtacatctaaacgcg | |||||
Mapping_target | T07A5 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031010 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004144 | ||||||
WBStrain00027163 | |||||||
WBStrain00027198 | |||||||
WBStrain00027199 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006785 | |||||
Transcript | T07A5.2.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | T07A5.2.1:c.552G>A | ||||||
HGVSp | CE36501:p.Trp184Ter | ||||||
cDNA_position | 584 | ||||||
CDS_position | 552 | ||||||
Protein_position | 184 | ||||||
Exon_number | 4/6 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
Interactor | WBInteraction000503020 | ||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00031010 | |||
Genetics | Interpolated_map_position | III | 2.3086 | ||||
Mapping_data | In_2_point | 56 | |||||
75 | |||||||
In_multi_point (20) | |||||||
In_pos_neg_data | 650 | ||||||
1619 | |||||||
2722 | |||||||
3243 | |||||||
5726 | |||||||
5734 | |||||||
Description | Phenotype (8) | ||||||
Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Recessive | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Mutants tend to remain within the borders of bacterial lawns as does the wild-type. | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Recessive | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Attraction to sodium chloride is normal (See methods). | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Recessive | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Recessive | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00035548 | ||||||
WBPaper00035074 | |||||||
WBPaper00000031 | |||||||
WBPaper00000484 | |||||||
Method | Substitution_allele |