WormBase Tree Display for Variation: WBVar00143154
expand all nodes | collapse all nodes | view schema
WBVar00143154 | Evidence | Paper_evidence | WBPaper00002050 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | Y60A3A | |||
Flanking_sequences | atagtcacacaataatcacccaacccagct | aatggagcagtttgacggcttcgagtacag | |||||
Mapping_target | Y60A3A | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002050 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (21) | |||||||
Laboratory | CB | ||||||
DCD | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00006786 | |||||
Transcript | Y60A3A.1.1 | VEP_consequence | 5_prime_UTR_variant | ||||
VEP_impact | MODIFIER | ||||||
HGVSc | Y60A3A.1.1:c.-2G>A | ||||||
cDNA_position | 64 | ||||||
Exon_number | 1/11 | ||||||
Interactor (21) | |||||||
Genetics | Interpolated_map_position | V | 24.4355 | ||||
Mapping_data | In_2_point | 137 | |||||
254 | |||||||
849 | |||||||
3379 | |||||||
3380 | |||||||
6116 | |||||||
6128 | |||||||
7012 | |||||||
7165 | |||||||
In_multi_point (22) | |||||||
In_pos_neg_data | 298 | ||||||
2143 | |||||||
Description | Phenotype (19) | ||||||
Phenotype_not_observed (8) | |||||||
Reference (25) | |||||||
Remark | e369 is a coupled mutation. In addition to the curated lesion there is a CAG to TAG substitution with flanking sequences agccgacgattcatgagaatgagccgttgg taatgcaaagtatcagcagacggatgttaa | Paper_evidence | WBPaper00002050 | ||||
Method | Substitution_allele |