WormBase Tree Display for Variation: WBVar00143369
expand all nodes | collapse all nodes | view schema
WBVar00143369 | Name | Public_name | e648 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE24899:p.Trp101Ter | ||||||||
F14F3.1a.1:c.303G>A | |||||||||
F14F3.1a.2:c.303G>A | |||||||||
HGVSg | CHROMOSOME_X:g.10511192G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F14F3 | |||||
Flanking_sequences | acaaacgtgaccaacctagcatttttgcatg | gaaatcagagataaactgctagctgataat | |||||||
Mapping_target | F14F3 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002236 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004190 | ||||||||
Laboratory | CB | ||||||||
CX | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006870 | |||||||
Transcript | F14F3.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F14F3.1a.1:c.303G>A | ||||||||
HGVSp | CE24899:p.Trp101Ter | ||||||||
cDNA_position | 605 | ||||||||
CDS_position | 303 | ||||||||
Protein_position | 101 | ||||||||
Exon_number | 6/14 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F14F3.1a.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F14F3.1a.2:c.303G>A | ||||||||
HGVSp | CE24899:p.Trp101Ter | ||||||||
cDNA_position | 395 | ||||||||
CDS_position | 303 | ||||||||
Protein_position | 101 | ||||||||
Exon_number | 5/13 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000003443 | ||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002236 | |||||
Genetics | Interpolated_map_position | X | 2.22423 | ||||||
Mapping_data | In_2_point | 164 | |||||||
3647 | |||||||||
3649 | |||||||||
3652 | |||||||||
3658 | |||||||||
3668 | |||||||||
In_multi_point | 648 | ||||||||
1325 | |||||||||
1326 | |||||||||
1339 | |||||||||
1341 | |||||||||
1342 | |||||||||
1346 | |||||||||
1353 | |||||||||
2065 | |||||||||
2314 | |||||||||
3211 | |||||||||
3296 | |||||||||
3321 | |||||||||
3322 | |||||||||
4023 | |||||||||
In_pos_neg_data | 293 | ||||||||
498 | |||||||||
874 | |||||||||
3646 | |||||||||
4979 | |||||||||
4981 | |||||||||
Description | Phenotype | WBPhenotype:0000189 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | disorganized hypodermal anatomy | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000379 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | notched head, especially in L1; 100% penetrance, dystrophy of ventral head regions | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants exhibited premature termination of the AWC axons | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000604 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | disorganized anterior sensory anatomy | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000668 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Emo | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001084 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | non-chemotactic to NaCl | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003571 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00003665 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | animals exhibit severe defects in amphid axon outgrowth extension | Paper_evidence | WBPaper00003665 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005394 | PATO:0000460 | Paper_evidence | WBPaper00003665 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001297 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | adult male tail variably deformed | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001414 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mating not successful | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | AWC specific str-2 expression Is altered: no str-2 expression in AWC | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003760 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00006052 | ||||||||
WBPaper00021796 | |||||||||
WBPaper00003665 | |||||||||
WBPaper00003760 | |||||||||
WBPaper00014771 | |||||||||
WBPaper00004825 | |||||||||
WBPaper00014973 | |||||||||
WBPaper00014314 | |||||||||
WBPaper00017246 | |||||||||
WBPaper00016625 | |||||||||
Remark | This allele has the same nucleotide mutation at the same position as ky664. It is mutated with the same mutagen as ky664, but obtained using a diferent screen. | Paper_evidence | WBPaper00002236 | ||||||
Method | Substitution_allele |