WormBase Tree Display for Variation: WBVar00143879
expand all nodes | collapse all nodes | view schema
WBVar00143879 | Evidence | Paper_evidence | WBPaper00031000 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e1272 | ||||||
Other_name | F25C8.3a.1:c.7512G>A | |||||||
CE43592:p.Trp2542Ter | ||||||||
CE41563:p.Trp2504Ter | ||||||||
CE47428:p.Trp2439Ter | ||||||||
F25C8.3b.1:c.7449G>A | ||||||||
CE47117:p.Trp2483Ter | ||||||||
F25C8.3e.1:c.7317G>A | ||||||||
F25C8.3d.1:c.7626G>A | ||||||||
F25C8.3c.1:c.7422G>A | ||||||||
CE47217:p.Trp2474Ter | ||||||||
HGVSg | CHROMOSOME_V:g.20895778G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F25C8 | ||||
Flanking_sequences | agcagcagttaaacatgaaatatcgcaatg | atcacaatggctgtcgaaatgaaagcttta | ||||||
Mapping_target | F25C8 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031000 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004286 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006812 | ||||||
Transcript | F25C8.3d.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F25C8.3d.1:c.7626G>A | |||||||
HGVSp | CE43592:p.Trp2542Ter | |||||||
cDNA_position | 7626 | |||||||
CDS_position | 7626 | |||||||
Protein_position | 2542 | |||||||
Exon_number | 31/37 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
F25C8.3b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F25C8.3b.1:c.7449G>A | |||||||
HGVSp | CE47117:p.Trp2483Ter | |||||||
cDNA_position | 7702 | |||||||
CDS_position | 7449 | |||||||
Protein_position | 2483 | |||||||
Exon_number | 29/36 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
F25C8.3e.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F25C8.3e.1:c.7317G>A | |||||||
HGVSp | CE47428:p.Trp2439Ter | |||||||
cDNA_position | 7317 | |||||||
CDS_position | 7317 | |||||||
Protein_position | 2439 | |||||||
Exon_number | 27/34 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
F25C8.3c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F25C8.3c.1:c.7422G>A | |||||||
HGVSp | CE47217:p.Trp2474Ter | |||||||
cDNA_position | 7422 | |||||||
CDS_position | 7422 | |||||||
Protein_position | 2474 | |||||||
Exon_number | 29/35 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
F25C8.3a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F25C8.3a.1:c.7512G>A | |||||||
HGVSp | CE41563:p.Trp2504Ter | |||||||
cDNA_position | 7512 | |||||||
CDS_position | 7512 | |||||||
Protein_position | 2504 | |||||||
Exon_number | 30/37 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
Interactor | WBInteraction000052191 | |||||||
WBInteraction000052325 | ||||||||
WBInteraction000052354 | ||||||||
WBInteraction000503536 | ||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00031000 | ||||
Genetics | Interpolated_map_position | V | 25.6082 | |||||
Description | Phenotype | WBPhenotype:0000044 | Paper_evidence | WBPaper00000958 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals lay unusually small eggs. | Paper_evidence | WBPaper00000958 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | slightly sluggish | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001048 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | hypersensitive to volatile anaesthetics | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001592 | Paper_evidence | WBPaper00000958 | ||||||
WBPaper00031592 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Fainter phenotype reported to authors by J.A. Lewis. | Paper_evidence | WBPaper00000958 | |||||
Curator_confirmed | WBPerson712 | |||||||
Animals exhibit recessive and fully penetrant fainter phenotypes identical to that of the nca(lf) double mutant. | Paper_evidence | WBPaper00031592 | ||||||
Curator_confirmed | WBPerson712 | |||||||
tends to pause ("fainter") | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00000958 | ||||||
WBPaper00031592 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001610 | Paper_evidence | WBPaper00002037 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | 50 animals were scored for mobility for 10 sec at each concentration of anesthetic. Immobility was used as the end point, which in all cases was reversible 10-15 min after removal from the anesthetic. Animals were tested over a minimum of 12 concentrations. EC50 = percent volume at which 50% animals were immobile for 10 sec. | Paper_evidence | WBPaper00002037 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 22-24C | Paper_evidence | WBPaper00002037 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001611 | Paper_evidence | WBPaper00000958 | ||||||
WBPaper00002037 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals have a lower EC50 (1.28 0.04 vol%) compared to N2 (3.2 0.06 vol%). By 2 vol% halothane, virtually all unc-80 animals were completely immobile. EC50 is the effective dose at which 50% of the animals are anesthetized. | Paper_evidence | WBPaper00000958 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00000958 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Anesthetic response assay was performed as described in Morgan and Cascorbi, 1985. Briefly, agar plates of worms were placed in a sealed chamber, which was injected with halothane. Worms were observed through the lid of the chamber under a dissecting scope. When the animals stopped moving and assumed a straight posture they were considered anesthesized. The gas in the chamber was removed and its concentration determined with a gas chromatograph. | Paper_evidence | WBPaper00000958 | ||||
Curator_confirmed | WBPerson712 | |||||||
50 animals were scored for mobility for 10 sec at each concentration of anesthetic. Immobility was used as the end point, which in all cases was reversible 10-15 min after removal from the anesthetic. Animals were tested over a minimum of 12 concentrations. EC50 = percent volume at which 50% animals were immobile for 10 sec. | Paper_evidence | WBPaper00002037 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 22-24C | Paper_evidence | WBPaper00002037 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0001608 | Paper_evidence | WBPaper00002037 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | 50 animals were scored for mobility for 10 sec at each concentration of anesthetic. Immobility was used as the end point, which in all cases was reversible 10-15 min after removal from the anesthetic. Animals were tested over a minimum of 12 concentrations. EC50 = percent volume at which 50% animals were immobile for 10 sec. | Paper_evidence | WBPaper00002037 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 22-24C | Paper_evidence | WBPaper00002037 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001609 | Paper_evidence | WBPaper00002037 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | 50 animals were scored for mobility for 10 sec at each concentration of anesthetic. Immobility was used as the end point, which in all cases was reversible 10-15 min after removal from the anesthetic. Animals were tested over a minimum of 12 concentrations. EC50 = percent volume at which 50% animals were immobile for 10 sec. | Paper_evidence | WBPaper00002037 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 22-24C | Paper_evidence | WBPaper00002037 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0004018 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | good movement | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00014310 | |||||||
WBPaper00000958 | ||||||||
WBPaper00002037 | ||||||||
WBPaper00031592 | ||||||||
WBPaper00003257 | ||||||||
Method | Substitution_allele |