WormBase Tree Display for Variation: WBVar00144275
expand all nodes | collapse all nodes | view schema
WBVar00144275 | Evidence | Paper_evidence | WBPaper00003082 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1745 | |||||||
Other_name | e1745ts | ||||||||
CE51835:p.Trp1094Ter | |||||||||
CE32051:p.Trp1072Ter | |||||||||
F56D1.4d.1:c.3210G>A | |||||||||
F56D1.4e.1:c.3282G>A | |||||||||
F56D1.4a.1:c.3216G>A | |||||||||
F56D1.4b.1:c.3321G>A | |||||||||
CE32052:p.Trp1107Ter | |||||||||
CE26369:p.Trp1070Ter | |||||||||
HGVSg | CHROMOSOME_II:g.5472274G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F56D1 | |||||
Flanking_sequences | tgtgttcatctacaaagcacttgcggaatg | cacatgtatggtgatactgatgaagatgtt | |||||||
Mapping_target | F56D1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003082 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (24) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000548 | |||||||
Transcript | F56D1.4a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F56D1.4a.1:c.3216G>A | ||||||||
HGVSp | CE32051:p.Trp1072Ter | ||||||||
cDNA_position | 3331 | ||||||||
CDS_position | 3216 | ||||||||
Protein_position | 1072 | ||||||||
Exon_number | 17/20 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F56D1.4e.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F56D1.4e.1:c.3282G>A | ||||||||
HGVSp | CE51835:p.Trp1094Ter | ||||||||
cDNA_position | 3282 | ||||||||
CDS_position | 3282 | ||||||||
Protein_position | 1094 | ||||||||
Exon_number | 17/20 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F56D1.4b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F56D1.4b.1:c.3321G>A | ||||||||
HGVSp | CE32052:p.Trp1107Ter | ||||||||
cDNA_position | 3417 | ||||||||
CDS_position | 3321 | ||||||||
Protein_position | 1107 | ||||||||
Exon_number | 18/21 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
F56D1.4d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F56D1.4d.1:c.3210G>A | ||||||||
HGVSp | CE26369:p.Trp1070Ter | ||||||||
cDNA_position | 3326 | ||||||||
CDS_position | 3210 | ||||||||
Protein_position | 1070 | ||||||||
Exon_number | 17/20 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor (35) | |||||||||
Genetics | Interpolated_map_position | II | -1.29801 | ||||||
Mapping_data | In_2_point | 4225 | |||||||
In_multi_point | 850 | ||||||||
851 | |||||||||
852 | |||||||||
853 | |||||||||
881 | |||||||||
882 | |||||||||
1384 | |||||||||
1789 | |||||||||
2326 | |||||||||
3137 | |||||||||
In_pos_neg_data (7) | |||||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Inviable at 25C. Easy to score (ES3) at 25C, difficult to score (ES2) at 20C. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "At 18C, clr-1(e1745) animals are phenotypically wild-type for fluid accumulation and exhibit normal patterns of DTC migration (Fig. 4B). However, in double mutants with an unc-5 hypomorph or null allele, a significant increase in the frequency of anterior and/or posterior DTC migration defects was observed (Fig. 4C)." | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 18 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | unc-5(e152) | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
unc-5(e53) | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
unc-5(ev585) | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000426 | Paper_evidence | WBPaper00006119 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Induces an increase in di-phosphorylation of MPK-1 at restrictive temperature | Paper_evidence | WBPaper00006119 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00006119 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
WBPhenotype:0000691 | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The severe phenotype of clr-1(e1745) when shifted to the restrictive temperature of 25C, including gonadal rupture, precludes examination of the effects of a strong reduction of function of clr-1 (Fig. 4A)." | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000882 | Person_evidence | WBPerson33324 | |||||||
Curator_confirmed | WBPerson33324 | ||||||||
Remark | PVD branching defect and ectopic branches increase when shifting to the restrictive temperature | Person_evidence | WBPerson33324 | ||||||
Curator_confirmed | WBPerson33324 | ||||||||
WBPhenotype:0001010 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | starved translucent appearance at 20C, facilitating Nomarski visualization of neuron processes; phenocopied by growth on 1mM orthovanadate. Inviable at 25C. Suppresses egl-15(n1477ts), and SM Mig defect of egl-17(1313)ES3 (25C) ES2 (20C) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00006119 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Induces muscle protein degradation at restrictive temperature | Paper_evidence | WBPaper00006119 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00006119 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Phenotype_not_observed | WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "At 18C, clr-1(e1745) animals are phenotypically wild-type for fluid accumulation and exhibit normal patterns of DTC migration (Fig. 4B)." | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 18 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001984 | Paper_evidence | WBPaper00038105 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit any short- or long-range axon migration defects. | Paper_evidence | WBPaper00038105 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001985 | Paper_evidence | WBPaper00038105 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit any short- or long-range axon migration defects. | Paper_evidence | WBPaper00038105 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002469 | Paper_evidence | WBPaper00038487 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The probability and size of response to plate taps decreased with continued taps applied with a 10s interval, similar to the response of N2 animals. | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004027 | Paper_evidence | WBPaper00038487 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit an escape response (reversal) similar to N2 animals upon an initial plate tap. | Paper_evidence | WBPaper00038487 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (20) | |||||||||
Method | Substitution_allele |