WormBase Tree Display for Variation: WBVar00146522
expand all nodes | collapse all nodes | view schema
WBVar00146522 | Evidence | Paper_evidence | WBPaper00003548 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | h289 | |||||||
Other_name | B0207.4.2:c.630G>A | ||||||||
CE24761:p.Trp210Ter | |||||||||
B0207.4.1:c.630G>A | |||||||||
HGVSg | CHROMOSOME_I:g.5938301G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0207 | |||||
Flanking_sequences | TGGTGAATGGAGCCGATCACAGTGACGCAGTTGACTTATG | GCAATCGGCGTTCTCTGCTATGAGTTTCTCGTTGGAAAAC | |||||||
Mapping_target | CHROMOSOME_I | ||||||||
Source_location | 200 | CHROMOSOME_I | 5938303 | 5938303 | |||||
Type_of_mutation | Substitution | G | A | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00023752 | ||||||||
Laboratory | KR | ||||||||
Analysis | WGS_Rose | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000099 | |||||||
Transcript | B0207.4.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0207.4.1:c.630G>A | ||||||||
HGVSp | CE24761:p.Trp210Ter | ||||||||
cDNA_position | 637 | ||||||||
CDS_position | 630 | ||||||||
Protein_position | 210 | ||||||||
Exon_number | 5/7 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
B0207.4.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0207.4.2:c.630G>A | ||||||||
HGVSp | CE24761:p.Trp210Ter | ||||||||
cDNA_position | 711 | ||||||||
CDS_position | 630 | ||||||||
Protein_position | 210 | ||||||||
Exon_number | 6/8 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | I | 0.482348 | ||||||
Mapping_data | In_2_point | 5225 | |||||||
5226 | |||||||||
In_pos_neg_data (12) | |||||||||
Description | Phenotype (6) | ||||||||
Phenotype_not_observed | WBPhenotype:0000670 | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | none of the sterile mutants were rescued by wild-type sperm, thereforenone of them had defects in spermatogenesis alone. | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002829 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040589 | ||||||||
WBPaper00003548 | |||||||||
WBPaper00002829 | |||||||||
WBPaper00000975 | |||||||||
WBPaper00003985 | |||||||||
WBPaper00000699 | |||||||||
WBPaper00045317 | |||||||||
Method | Substitution_allele |