WormBase Tree Display for Variation: WBVar00241238
expand all nodes | collapse all nodes | view schema
| WBVar00241238 | Evidence | Paper_evidence | WBPaper00006240 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | qm30 | |||||
| Other_name | qm30tsmat | ||||||
| HGVSg | CHROMOSOME_III:g.5278938_5279527del | ||||||
| Sequence_details | SMap | S_parent | Sequence | ZC395 | |||
| Flanking_sequences | acaagattacgtgatgaggagcttcatcat | aacttctgatgatgaccagaactttttttc | |||||
| Mapping_target | ZC395 | ||||||
| Type_of_mutation | Deletion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00026639 | ||||||
| WBStrain00026647 | |||||||
| Laboratory | MQ | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000536 | |||||
| Transcript | ZC395.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| cDNA_position | 454-? | ||||||
| CDS_position | 454-? | ||||||
| Protein_position | 152-? | ||||||
| Intron_number | 4/5 | ||||||
| Exon_number | 4-6/6 | ||||||
| Interactor (69) | |||||||
| Genetics | Interpolated_map_position | III | -1.84661 | ||||
| Description | Phenotype (25) | ||||||
| Phenotype_not_observed | WBPhenotype:0000114 | Paper_evidence | WBPaper00046786 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| Remark | clk-1(qm30) does not affect mRNA levels of the gene hsp-4 | Paper_evidence | WBPaper00046786 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| WBPhenotype:0000246 | Paper_evidence | WBPaper00031896 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Although animals exhibited an extended mean time between execution of the defecation motor program, the variance between DMP activation was not significantly different from wild-type. | Paper_evidence | WBPaper00031896 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001574 | Paper_evidence | WBPaper00036073 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | ATP levels are normal, with a trend towards and increase, despite decreased mitochondrial function. | Paper_evidence | WBPaper00036073 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0002087 | Paper_evidence | WBPaper00031326 | |||||
| Curator_confirmed | WBPerson2857 | ||||||
| Remark | growth in hydrogen sulfide enhances thermotolerance relative to untreated animals | Paper_evidence | WBPaper00031326 | ||||
| Curator_confirmed | WBPerson2857 | ||||||
| Reference | WBPaper00038379 | ||||||
| WBPaper00039867 | |||||||
| WBPaper00041212 | |||||||
| WBPaper00041370 | |||||||
| WBPaper00041750 | |||||||
| WBPaper00017902 | |||||||
| WBPaper00015392 | |||||||
| WBPaper00011038 | |||||||
| WBPaper00021890 | |||||||
| WBPaper00017025 | |||||||
| WBPaper00036073 | |||||||
| WBPaper00031896 | |||||||
| WBPaper00027157 | |||||||
| WBPaper00006515 | |||||||
| WBPaper00031326 | |||||||
| WBPaper00006155 | |||||||
| WBPaper00027130 | |||||||
| WBPaper00010277 | |||||||
| WBPaper00025727 | |||||||
| WBPaper00016841 | |||||||
| WBPaper00018757 | |||||||
| WBPaper00005534 | |||||||
| WBPaper00006261 | |||||||
| WBPaper00015771 | |||||||
| WBPaper00006240 | |||||||
| WBPaper00045829 | |||||||
| WBPaper00046786 | |||||||
| WBPaper00051094 | |||||||
| WBPaper00055188 | |||||||
| WBPaper00065803 | |||||||
| Method | Deletion_allele |
