WormBase Tree Display for Variation: WBVar00241265
expand all nodes | collapse all nodes | view schema
WBVar00241265 | Name | Public_name | qm160 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C09H6.3.1:c.99_1114-52del | ||||||||
HGVSg | CHROMOSOME_I:g.8125905_8127927del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C09H6 | |||||
Flanking_sequences | gaagttaaaaatggcaattaaatgtgcaag | attgtagaatttgcgaaaataattgctatc | |||||||
Mapping_target | C09H6 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026668 | ||||||||
Laboratory | MQ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003136 | |||||||
Transcript | C09H6.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C09H6.3.1:c.99_1114-52del | ||||||||
cDNA_position | 105-? | ||||||||
CDS_position | 99-? | ||||||||
Protein_position | 33-? | ||||||||
Intron_number | 2-6/10 | ||||||||
Exon_number | 2-6/11 | ||||||||
Genetics | Interpolated_map_position | I | 2.56101 | ||||||
Description | Phenotype | WBPhenotype:0001278 | Paper_evidence | WBPaper00054564 | |||||
Curator_confirmed | WBPerson3890 | ||||||||
Remark | Figure 5, reduced expression of Pabts-1b::gfp in HSNs. | Paper_evidence | WBPaper00054564 | ||||||
Curator_confirmed | WBPerson3890 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00054564 | ||||
Curator_confirmed | WBPerson3890 | ||||||||
Reference | WBPaper00054564 | ||||||||
Remark | This deletion is 1992bp long and causes codon 66 in exon 1 to join to the last 54bp of intron 5. This produces two inframe stop codons | Paper_evidence | WBPaper00024594 | ||||||
Method | Deletion_allele |